Method for expressing and purifying neutral protease (NPR)
A technology of neutral protease and expression method, which is applied in botany equipment and methods, biochemical equipment and methods, hydrolytic enzymes, etc. It can solve the problems of difficult to obtain ideal expression and low protein purity, and achieve high expression and simple purification Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1: Construction of recombinant plasmid pET28b-NPR
[0039] 1) Design specific primers to amplify the full-length gene by PCR
[0040]Comprehensively analyze the restriction map of NPR and the sequence characteristics of the multiple cloning site (MCS) of the pET28b vector (Novagen), and then design primers, respectively introduce BglII and XhoI restriction sites in the upstream and downstream, and perform NPR PCR under the following reaction conditions After amplification, a fragment of about 2000bp was obtained, which conformed to the theoretical fragment size and could be used for gene cloning.
[0041] Upstream primer: GAGATCTAAGCTTTTATTAGGAAT
[0042] Downstream primer: G CTCGAG TTTCACCCCTAC
[0043] When doing the PCR reaction, the enzyme used is a high-fidelity DNA polymerase; the final concentration of the primers is 0.5uM; the template is the chemically synthesized NPR whole gene sequence.
[0044] 94°C, 5min, 1 cycle; 94°C, 20s, 54°C, 20S, 72°C, 1min...
Embodiment 2
[0049] Embodiment 2: the expression of fusion protein
[0050] 1) Transform Rosetta (DE3) expression strain (Novagen) and express
[0051] The correct recombinant plasmid pET28b-NPR analyzed by the sequencing results was transformed into a Rosetta (DE3) expression strain, and a single colony was removed. After a small amount of cultivation, it was transferred to 500mL LB medium at an inoculum size of 1% for cultivation and expression. , Take it out after 24 hours, collect and save the supernatant after centrifugation.
[0052] 2) SDS-PAGE detection of expressed protein
[0053] The supernatant was detected by SDS-PAGE, and faint bands could be seen. This was because the volume of the LB supernatant was too large, resulting in too low protein concentration in the sample; the protein in the sample was concentrated by TCA precipitation, and then SDS-PAGE Detection showed obvious protein bands.
Embodiment 3
[0054] Embodiment 3: Purification and identification of NPR protein
[0055] 1) NPR affinity nickel column purification
[0056] Since the inventors retained the His tag at the 3' end of the pET28b vector MCS when constructing the recombinant plasmid and expressed it directly behind the NPR, the expressed NPR can directly use the His tag at the 3' end to pass through the affinity nickel column. Purify it. During purification, equilibrate the nickel column and system with a low concentration (20mM) of imidazole, and use a certain percentage of high concentration (500mM) of imidazole for elution, and collect the breakthrough and each elution peak.
[0057] 2) SDS-PAGE detection of the first collected peak after purification
[0058] After the collected peaks were partly precipitated by TCA, they were detected by SDS-PAGE, and an obvious and single expression band could be seen in the elution peak, about 40KDa, slightly larger than the theoretical (37KDa).
[0059] 3) Western ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com