Primer, probe and method for detecting respiratory infectious disease pathogen by using liquid chip

A liquid-phase chip detection and respiratory technology, applied in the field of medical monitoring, can solve the problems of many materials required for detection, unfavorable diagnosis of virus infection, and long detection cycle

Inactive Publication Date: 2011-09-14
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The pathogen culture and isolation detection method is a traditional detection technology, the detection result is accurate and reliable, but the sensitivity is low, the detection cycle is long, which is not conducive to the early diagnosis of viral infection; the sensitivity and specificity of immunological detection are strong, but The detection requires more materials and the results of the determination are related to the source and affinity of the antibody; the nucleic acid PCR detection method is a detection method with high sensitivity at present, and the detection rate is higher than that of the pathogen isolation method, but when the PCR target sequence mutation occurs prone to false negative results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0085] It is known that sample 1 contains human respiratory syncytial virus type A (HRSV-A), and it is detected according to the method of the present invention, and the specific steps are as follows:

[0086] a. Extract the total RNA in the sample.

[0087] b. Using the sample total RNA extracted in step a as a template, carry out PCR with primer F and primer R of each virus respectively, and each primer sequence is as follows:

[0088] HRSV A-F: CTGGTCCGTACTTCCGAGCGCAGCTTATCAAATGGAGTTAGTG

[0089] HRSV A-R: TACAGTCGGTCGCGTGCCTCTCATTTGTTATAGGCATATCATTG

[0090] HRSV B-F: CTGGTCCGTACTTCCGAGCGAGGTGTAGGATCTGCAATAGC

[0091] HRSV B-R: TACAGTCGGTCGCGTGCCTCCAATGTTGGAGATGCGACAGC

[0092] InfV A-F: CTGGTCCGTACTTCCGAGCGACAGCATCGGTCTCACAGAC

[0093] InfV A-R: TACAGTCGGTCGCGTGCCTCCTTGAATCGCTGCATCTGCAC

[0094] InfV B-F: CTGGTCCGTACTTCCGAGCGTGTGAGCTTTCATGAAGCATTTG

[0095] InfV B-R: TACAGTCGGTCGCGTGCCTCTTCATAGCTGAGACCATCTGC

[0096]SARS-F: CTGGTCCGTACTTCCGAGCGTACACACCTCACGCGTTG

...

example 2

[0138] It is known that the sample contains human respiratory syncytial virus type B (HRSV-B), and it is detected according to the method of the present invention. The specific steps are the same as in Example 1, and the results of the fluorescence detection value are as follows:

[0139] When the first round of PCR primer F and the first round of PCR primer R in step b are human respiratory syncytial virus type A primers HRSV A-F and HRSV A-R, the probe in step e is human respiratory syncytial virus type A probe HRSV A-probe When the fluorescence detection value is 46, it is confirmed that the sample does not contain human respiratory syncytial virus type A;

[0140]When the first round of PCR primer F and the first round of PCR primer R in step b are human respiratory syncytial virus type B primers HRSV B-F and HRSV B-R, and the probe of step e is human respiratory syncytial virus type B probe HRSV B-probe, The fluorescence detection value was 864, confirming that the sample...

example 3

[0150] It is known that the sample contains influenza virus type A (InfV A), and it is detected according to the method of the present invention. The specific steps are the same as in Example 1, and the results of the fluorescence detection value are as follows:

[0151] When the first round of PCR primer F and the first round of PCR primer R in step b are human respiratory syncytial virus type A primers HRSV A-F and HRSV A-R, the probe in step e is human respiratory syncytial virus type A probe HRSV A-probe When the fluorescence detection value is 12, it is confirmed that the sample does not contain human respiratory syncytial virus type A;

[0152] When the first round of PCR primer F and the first round of PCR primer R in step b are human respiratory syncytial virus type B primers HRSV B-F and HRSV B-R, and the probe of step e is human respiratory syncytial virus type B probe HRSV B-probe, The fluorescence detection value is 34, confirming that the sample does not contain h...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer, a probe and a method for detecting a respiratory infectious disease pathogen by using a liquid chip, which are used for detecting nine clinically common respiratory infectious disease pathogens. In the invention, the nine clinically common respiratory infectious disease pathogens are detected by a multi-analyte suspension array (MASA) liquid chip technology and are subjected to homology analysis mainly according to all nucleotide sequences of nine targeted viruses which can be searched in a gen bank; a degenerate primer and a specific probe are designed; and a polymerase chain reaction (PRC) and molecular hybridization are performed for two times, and then a Luminex 100 system is used for detection, so that the types of the pathogens in a sample are determined. The detection and early diagnosis of the nine clinically common respiratory infectious disease pathogens provided by the invention are extremely significant in the aspect of preventing diseasesfrom propagating by correct treatment schemes and timely responding measures. The primer, the probe and the method have the advantages of high detection speed, high sensitivity, high specificity and the like, are easy to operate and are suitable for large-scale popularization and application.

Description

technical field [0001] The invention relates to the detection of nine common clinical respiratory infectious disease pathogens, in particular to the detection of nine clinical common respiratory infectious disease pathogens by means of a liquid phase chip, which belongs to the technical field of medical monitoring. Background technique [0002] Human respiratory syncytial virus type A (HRSV-A), human respiratory syncytial virus type B (HRSV-B), influenza virus type A (InfV A), influenza virus type B (InfV B), SARS, parainfluenza virus I Parainfluenza virus type II (PIV-2), parainfluenza virus type III (PIV-3), and mumps virus (PIV-1) are nine common clinical pathogens of major human respiratory infectious diseases in my country. Among them, influenza virus types A and B, and mumps virus are the legal pathogens of class C infectious diseases. These 9 pathogens are mainly transmitted through the respiratory tract, and the transmission speed is fast, which can easily cause larg...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11G01N21/64
Inventor王华林尹飞飞邓菲胡志红
OwnerWUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI