Protein related with arsenic resistance of plants, and coding gene and application thereof

A technology that encodes genes and proteins, applied in plant gene improvement, application, plant peptides, etc., can solve the problems of no research reports

Inactive Publication Date: 2011-09-21
INST OF BOTANY CHINESE ACAD OF SCI
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Then, which protein(s) cooperate with PvABCT1 transporter in the transport, accumulation and detoxification of arsenic in Centipede Grass? There are currently no relevant research reports

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein related with arsenic resistance of plants, and coding gene and application thereof
  • Protein related with arsenic resistance of plants, and coding gene and application thereof
  • Protein related with arsenic resistance of plants, and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Embodiment 1, discovery of gene

[0040] 1. Library Construction and Screening

[0041] 1. Extraction of Centipede Grass RNA

[0042] The quality of RNA samples will directly affect the quality of the constructed library and the final screening results, so the RNA extraction process requires strict specifications. Centipede Grass is rich in polyphenols and polysaccharides, and common RNA extraction methods (such as guanidine hydrochloride method, TRIZOL method, etc.) are difficult to obtain high-quality RNA. In order to obtain high-quality Centipede grass RNA, the spores collected from the greenhouse were cultured on the medium of sodium arsenate 2mM for 45 days, and the formed prothallus were subcultured once on the medium of sodium arsenate 2mM for 35 days . Pick well-grown prothallus to extract RNA, and perform ordinary rapid electrophoresis on the extracted RNA, and at the same time, analyze the OD of the sample 260 / 280 And the concentration was measured, the re...

Embodiment 2

[0052] Embodiment 2, the cloning and function analysis of gene

[0053] 1. Gene preparation

[0054] Artificially synthesize the following pair of primers:

[0055] Upstream primer: gacccgggatgatgatgagggcgcg (XmaI site is underlined)

[0056] Downstream primer: cgggatccaggaatcgaggcacag (underlined Bam HI site)

[0057] With the cDNA (obtained by reverse transcription of the extracted RNA) of Grass centipede (the public can be purchased from Bozhou Baohua Pharmaceutical Co., Ltd.) as a template, the above-mentioned pair of primers are used to carry out PCR amplification, and the result is a 412bp amplified product ( with enzyme cleavage sites).

[0058] 2. Functional analysis of genes

[0059] 1. Construction of recombinant yeast expression vector

[0060] After the amplified product of the above step 1 was digested with XmaI and BamHI, it was digested with the yeast overexpression vector pFL61 (available from ATCC Company, ATCC Number: 77215 TM ) were connected to constr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a protein related with arsenic resistance of plants, and a coding gene and application thereof. The protein comes from Pteris vittata L., and is protein (a) or protein (b), wherein the protein (a) has amino acid sequences shown as a sequence 2 in a sequence table; and the protein (b) has an amino acid residue sequence which is derived from the sequence 2 by substituting and / or losing and / or adding one or more amino acid residues and is related with the arsenic resistance of the plants. Experiments prove that: PvABCT1 and PvLTP1 are mutually acted in yeast and onion; moreover, the arsenic resistance of a yeast strain is improved after the PvLTP1 gene is transferred into the yeast strain through arsenic resistance detection, and the result shows that the PvLTP1 gene is related with the arsenic resistance of ciliate desert-grass.

Description

technical field [0001] The invention relates to a plant arsenic resistance-related protein, a coding gene and an application thereof. Background technique [0002] Lipid transfer proteins (lipid transfer proteins, LTPs) are widely distributed in plants, animals and microorganisms. They are an important class of active proteins in plant life activities, accounting for 4% of cell soluble proteins. In higher plants, LTPs have the characteristics of low molecular weight and high position conservation. Typical LTPs are peptide chain folded structures formed by α-helices connected by four disulfide bonds. The internal hydrophobic hole runs through the entire molecule. The existence of the hydrophobic hole is conducive to its binding to hydrophobic ligands (such as acyl chains, phospholipids) , and provide information for ligand binding and release. The isoelectric point of LTPs is close to 9, has 8 conserved cysteine ​​(Cys) sites, and has a typical signal peptide structure at t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10C12N15/11C12R1/865
Inventor何振艳麻密徐文忠陈宏林
OwnerINST OF BOTANY CHINESE ACAD OF SCI