Unlock instant, AI-driven research and patent intelligence for your innovation.

Dihydrodipicolinate synthase

A technology of dihydrodipicolinic acid and synthase is applied in the directions of enzymes, biochemical equipment and methods, bacteria, etc., to achieve the effect of fermentation cost advantages and production efficiency advantages

Inactive Publication Date: 2011-09-21
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI +1
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because the heterologous DHDPS is regulated differently in E. coli and in the original microorganism, or exhibits different activity properties in different catalytic environments, such as different fermentation temperatures and pHs, heterologous expression of different types of DHDPS It has different effects on the production of L-lysine. Finding DHDPS with high specific activity and high resistance to L-lysine feedback inhibition requires a lot of work and many difficulties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dihydrodipicolinate synthase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1 , Protein Homology Search

[0050] DHDPS of Escherichia coli DHDPS close homology microorganisms

[0051] After homology search, the activity of DHDPS of Escherichia coli is relatively high, and the DHDPS of Enterobacter, Escherichia and other genus and species microorganisms have high homology with their amino acid sequences; in addition, DHDPS of Bacillus subtilis has natural anti L-lysine feedback inhibitory ability, DHDPS derived from microorganisms such as Bacillus and other species have a high homology with its amino acid sequence. Therefore, the present invention selects each microorganism listed in Table 1 as candidate microorganisms.

Embodiment 2

[0052] Example 2 , the cloning of the dihydrodipicolinate synthase gene (dapA gene) of selected microorganisms

[0053] 2.1. Primer design

[0054] According to the nucleic acid sequences in the NCBI database, the cloning primers were designed, as shown in Table 1 below.

[0055] Table 1. Primer sequences

[0056] microorganism

Cloning Primer (5'-3')

Salmonella typhimurium LT2

CCATATGTTCACGGGAAGTATTGTC

CCTCGAGTTACAGCAGGCCAGCATG

Escherichia coli (Escherichia coli W3110)

CATATGTTCACGGGAAGTATT

CTCGAGTTACAGCAAACCGGCATG

Bacillus subtilis (Bacillus subtilis 168)

CATATGAATTTCGGAAATGTG

CTCGAGTTACAGTTCGCTGATCGT

Bacillus licheniformis

CATATGAACTTCGGAAATATC

CTCGAGTTACAGGCCGTTCATCAG

Bacillus amyloliquefaciens

CATATGAATGTCGGAAATATA

CTCGAGTTACAGTTCGCTGATGAC

Bacillus (Bacillus.sp.NRRL-B-14911)

CATATGGTTCTATTTGGAAGA

CTCGAGTTATTAGTTTTGGAACAA ...

Embodiment 3

[0093] Example 3 , the acquisition of DHDPS enzyme of the recombinant strain and the determination of its activity

[0094] 3.1. Obtaining the DHDPS enzyme of the recombinant strain

[0095] 31.1. Fermentation

[0096] According to the inoculum amount of 1%, inoculate the overnight seed bacterial solution into a Erlenmeyer flask containing 30ml of LB medium, add kanamycin 50μg / ml, and culture on a shaker at 37°C until the OD600 reaches 0.8, then add the final concentration 1 mM IPTG, induced culture at 30°C for 4 hours.

[0097] 3.1.2. Ultrasonic wall breaking

[0098] Take 1ml of the induced bacterial solution, centrifuge at 10000rpm, 4°C for 1min, discard the supernatant, add 400μl of the suspension solution to resuspend the bacterial cells, and ultrasonically disrupt (5s of ultrasound, 10s off, 20cycle). The suspension after breaking the wall was centrifuged at 10,000 rpm for 5 minutes, and the supernatant was taken, which was the recombinantly expressed DHDPS crude en...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses dihydrodipicolinate synthase and recombinant plasmid and recombination bacterial strain expressing the dihydrodipicolinate synthase. The DNA sequence of the dihydrodipicolinate synthase in the invention is represented as SEQ ID NO: 2, the coded amino acid sequence is represented as SEQ ID NO: 4. The recombinant plasmid includes the DNA sequence of the dihydrodipicolinate synthase and the recombination bacterial strain includes the above recombinant plasmid. The dihydrodipicolinate synthase in the invention has high specific activity and high anti L-lysine feedback inhibition capability, and can be used for the high efficiency production of L-lysine.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a dihydrodipicolinate synthase (DHDPS) derived from Salmonella typhimu-rium. Background technique [0002] L-Lysine is one of the essential amino acids for the human body, which can promote human development and enhance immune function. Because the content of L-lysine in grain food is very low, it is easily destroyed during processing, and the human body and animals cannot synthesize L-lysine by themselves, so it can only be obtained from food, so it is called a limiting amino acid. L-Lysine is mainly used in feed additives to supplement limiting amino acids to improve the absorption and utilization of feed, food additives, medicines, chemical preparations, etc. In terms of annual output, L-lysine is currently the second largest amino acid species in the world next to glutamic acid, and it is increasing at an annual growth rate of 5%-10%. [0003] The international prod...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/00C12N15/52C12N15/63C12N1/21C12P13/08C12R1/19
Inventor 杨晟黄鹤孙周通
Owner SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI