Dihydrodipicolinate synthase
A technology of dihydrodipicolinic acid and synthase is applied in the directions of enzymes, biochemical equipment and methods, bacteria, etc., to achieve the effect of fermentation cost advantages and production efficiency advantages
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Example 1 , Protein Homology Search
[0050] DHDPS of Escherichia coli DHDPS close homology microorganisms
[0051] After homology search, the activity of DHDPS of Escherichia coli is relatively high, and the DHDPS of Enterobacter, Escherichia and other genus and species microorganisms have high homology with their amino acid sequences; in addition, DHDPS of Bacillus subtilis has natural anti L-lysine feedback inhibitory ability, DHDPS derived from microorganisms such as Bacillus and other species have a high homology with its amino acid sequence. Therefore, the present invention selects each microorganism listed in Table 1 as candidate microorganisms.
Embodiment 2
[0052] Example 2 , the cloning of the dihydrodipicolinate synthase gene (dapA gene) of selected microorganisms
[0053] 2.1. Primer design
[0054] According to the nucleic acid sequences in the NCBI database, the cloning primers were designed, as shown in Table 1 below.
[0055] Table 1. Primer sequences
[0056] microorganism
Cloning Primer (5'-3')
Salmonella typhimurium LT2
CCATATGTTCACGGGAAGTATTGTC
CCTCGAGTTACAGCAGGCCAGCATG
Escherichia coli (Escherichia coli W3110)
CATATGTTCACGGGAAGTATT
CTCGAGTTACAGCAAACCGGCATG
Bacillus subtilis (Bacillus subtilis 168)
CATATGAATTTCGGAAATGTG
CTCGAGTTACAGTTCGCTGATCGT
CATATGAACTTCGGAAATATC
CTCGAGTTACAGGCCGTTCATCAG
CATATGAATGTCGGAAATATA
CTCGAGTTACAGTTCGCTGATGAC
Bacillus (Bacillus.sp.NRRL-B-14911)
CATATGGTTCTATTTGGAAGA
CTCGAGTTATTAGTTTTGGAACAA ...
Embodiment 3
[0093] Example 3 , the acquisition of DHDPS enzyme of the recombinant strain and the determination of its activity
[0094] 3.1. Obtaining the DHDPS enzyme of the recombinant strain
[0095] 31.1. Fermentation
[0096] According to the inoculum amount of 1%, inoculate the overnight seed bacterial solution into a Erlenmeyer flask containing 30ml of LB medium, add kanamycin 50μg / ml, and culture on a shaker at 37°C until the OD600 reaches 0.8, then add the final concentration 1 mM IPTG, induced culture at 30°C for 4 hours.
[0097] 3.1.2. Ultrasonic wall breaking
[0098] Take 1ml of the induced bacterial solution, centrifuge at 10000rpm, 4°C for 1min, discard the supernatant, add 400μl of the suspension solution to resuspend the bacterial cells, and ultrasonically disrupt (5s of ultrasound, 10s off, 20cycle). The suspension after breaking the wall was centrifuged at 10,000 rpm for 5 minutes, and the supernatant was taken, which was the recombinantly expressed DHDPS crude en...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 