Check patentability & draft patents in minutes with Patsnap Eureka AI!

Enterovirus type 71 (EV71) infectious clone and construction method

An infectious cloning and enterovirus technology, applied in the direction of virus/bacteriophage, microorganism-based methods, biochemical equipment and methods, etc., can solve the problem of no effective therapeutic drugs and vaccines for hand-mouth-foot disease, etc., and achieve infectious cloning Efficient and stable, high success rate, less difficult effect

Active Publication Date: 2014-03-12
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there is no effective treatment drug and vaccine for hand-mouth-foot disease caused by EV71 in China, mainly relying on comprehensive prevention and control measures

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Enterovirus type 71 (EV71) infectious clone and construction method
  • Enterovirus type 71 (EV71) infectious clone and construction method
  • Enterovirus type 71 (EV71) infectious clone and construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1. Obtaining of EV71 virus genome.

[0036] According to the molecular biology research on EV71 virus, referring to the relevant sequence published by GenBank (GenBank accession number: GU396280), after comparative analysis, three pairs of specific primers L1 upstream and downstream primers with modified amplification covering the whole genome were designed, L2 upstream and downstream primers and L3 upstream and downstream primers, these three specific primers are:

[0037] L1 upstream primer:

[0038]atagtc ttaatt aatgttaagcgtctgatgagtccgtgaggacgaaactataggaaaggaattcctatagtc

[0039] L1 downstream primer: gaag aagctt caagcacgtacgggtgttgcaactcgaag

[0040] L2 upstream primer: ttaag aagctt gcaggcggtacagggacggaagat

[0041] L2 downstream primer: tttgagatctgattc tctaga agtggcagctgt

[0042] L3 upstream primer: tcact tctaga gaatcagatctcaaatttggaacaat

[0043] L3 downstream primer: ttttctaga gcggccgc t 38 ;

[0044] In the above specific primers, a P...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses enterovirus type 71 (EV71) infectious clone and a construction method thereof. The construction method of the EV71 infectious clone comprises the following steps of: extracting RNA serving as a template from an EV17 strain, and amplifying three fragments L1, L2 and L3 by using the following three pairs of primers respectively; connecting the enzyme digested fragment L1 and a eukaryotic expression vector, transforming the connected fragment L1 and eukaryotic expression vector to escherichia coli to obtain a sub-cloned plasmid PL1, performing enzyme digestion, connection and transformation on the plasmid PL1 and the fragment L2 to obtain a plasmid PL2, and performing enzyme digestion, connection and transformation on the plasmid PL2 and the fragment L3 to obtain a full genome cDNA cloned recombinant plasmid containing the fragments L1, L2 and L3; and transfecting the recombinant plasmid to host cells of African green monkey kidney cells to obtain the EV71 infectious clone.

Description

technical field [0001] The invention relates to an infectious clone of a positive-strand RNA virus, in particular to an infectious clone of enterovirus 71 and a construction method thereof. Background technique [0002] Hand, foot and mouth disease in infants and young children caused by enterovirus type 71 (EV71) often forms a large-scale outbreak, and its main clinical features are fever, rashes and ulcers on the hands, feet, mouth and other parts, and individual patients can also cause myocarditis , pulmonary edema, aseptic meningitis and other fatal complications. Hand, foot and mouth disease occurs in all seasons, and the population is generally susceptible to the enterovirus that causes hand, foot and mouth disease. However, the ratio of recessive infection to dominant infection of the virus is 100:1, and most adults have acquired corresponding antibodies through recessive infection. Therefore, HFMD patients are mainly preschool children. [0003] At present, there a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/85C12N7/00C12R1/93
Inventor 郑海学李建强曹伟军杨帆王玉琳刘湘涛
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More