Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for constructing pSU6-miR-122 vector expressing miR-122 and application of pSU6-miR-122 vector

A psu6-mir-122, construction method technology, applied in the field of constructing vectors expressing miR-122, can solve problems such as HBV drug resistance

Inactive Publication Date: 2011-10-12
WUHAN UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, anti-hepatitis B drug α-interferon is currently recognized as the first choice drug for the treatment of chronic hepatitis B, but its curative effect can only make 25% to 40% of cases effective; The short-term curative effect of infection has been affirmed, but long-term application can induce drug resistance of HBV

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing pSU6-miR-122 vector expressing miR-122 and application of pSU6-miR-122 vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Below in conjunction with accompanying drawing, the present invention is described in further detail:

[0024] A construction method that can be used to express miR-122 vector pSU6-miR-122, the steps are:

[0025] a. Chemically synthesized oligonucleotide strand, sense strand (SEQ ID NO.1): 5’-GGATCCAGCTGTGGAGTGTCGAAATGGTGTTTGTGTCCAAACTATCAAACGCCATTTCAACACTAAATAGCTTTTTTGGAAA-3’

[0026] Antisense strand (SEQ ID NO.2): 5'-AGCTTTCCAAAAAAGCTATTTAGTGTTGAAATGGCGTTTGATAGTTTGGACACAAACACCATTTCGACACTCCACAGCTGG is complementary to the sense strand, and AGCT is added at the 5' end to create sticky overhangs.

[0027] b. The sense strand and antisense strand anneal to form a band BamHI and Hind III cohesive-ended fragments;

[0028] c. Ligate the fragment obtained in step b to the vector pSilencer-2.1-U6 (purchased from Ambion: the vector is made of BamHI and Hind III double digestion);

[0029] d. Transform Escherichia coli Stbl3 competent cells (the Stbl3 strain was pur...

Embodiment 2

[0033] A kind of vector pSU6-miR-122 expressing miR-122 is used in the preparation of the medicine for treating or preventing hepatitis B virus, and its steps are:

[0034] A. pSU6-miR-122 inhibits the expression of hepatitis B virus HBsAg and HBeAg:

[0035] B. Transfect HepG2.2.15 cells with pSU6-miR-122, detect HBsAg and HBeAg with ELISA kit after 24 hours (the detection kit was purchased from Shanghai Kehua Bioengineering), the level of HBsAg decreased by 67.3%, and the level of HBeAg decreased by 78.5% .

Embodiment 3

[0037] An application of expressing miR-122 carrier pSU6-miR-122 in the preparation of medicines for treating or preventing hepatitis B virus, the steps are:

[0038] A, pSU6-miR-122 inhibits the transcription and viral replication of the hepatitis B virus genome, and co-transfects HepG2 cells with pSU6-miR-122 and the expression vector pHBV1.3 with 1.3 times the length of the HBV gene;

[0039] After 24 hours, the level of hepatitis B virus genomic DNA (cccDNA) linked to capsid was detected by qRT-PCR and decreased by 85.2% (the detection kit was purchased from Shenzhen Piji Company).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing a pSU6-miR-122 vector capable of being used for expressing miR-122 and application of the pSU6-miR-122 vector. The method comprises the following steps of: a, chemically synthesizing oligonucleotide chains, wherein antisense chains and sense chains are complementary; adding AGCT onto the 5' end to form a viscous protruding end; b, annealing the sense chains and the antisense chains so as to form a segment with BamHI and HindIII viscous ends; c, linking the segment to a vector pSilencer-2.1-U6, wherein the vector is doubly digested by BamHI and HindIII; d, transforming colibacillus Stb13 competent cells; and e, screening positive clones to obtain Psu6-miR-122 vector plasmids expressing the miR-122. According to the application of the vector in drugs for inhibiting hepatitis B virus, the efficiency for resisting hepatitis B virus infection is high; the specificity is strong; the vector is non-toxic to normal cells; and the inhibition ratio to hepatitis B virus replication is 85.2%.

Description

Technical field: [0001] The present invention relates to the fields of molecular biology, virology and gene therapy, and more specifically relates to a method for constructing a vector for expressing miR-122, and the use of the vector in medicines for inhibiting hepatitis B virus. Background technique: [0002] Hepatitis B virus (HBV) is a member of the Mammalian virus genus in the Hepadnavirus family. HBV has a 3.2kb partially double-stranded genome, including four open reading frames, which are the C gene encoding the nucleocapsid, the P gene encoding the polymerase, the S gene encoding the outer membrane protein, and the regulation of viral gene transcription levels. protein X. Hepatitis B virus (HBV) infection can cause acute and chronic liver disease. Every year, more than 1 million people die from liver cirrhosis or liver cancer caused by hepatitis B virus infection all over the world. The virus infects as many as 50,000 people each year. Worldwide, about 2 billion...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85A61K48/00A61P31/20
Inventor 吴建国邬开朗陈燕妮朱应
Owner WUHAN UNIV