Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit for identifying Mycobacterium tuberculosis and nontuberculous mycobacteria and application method thereof

A technology for Mycobacterium tuberculosis and Mycobacterium tuberculosis, which is applied in biochemical equipment and methods, material stimulation analysis, and microbial determination/inspection, etc. and other problems, to achieve the effect of short detection time and accurate classification

Inactive Publication Date: 2011-11-02
亚能生物技术(深圳)有限公司
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] (2) Low pathogenicity
[0008] (3) There are large differences in clinical symptoms
[0010] (5) High drug resistance rate
[0013] At present, the prevention and control of tuberculosis infection in my country is facing two major problems: one is the generation and spread of multidrug resistance (MDR) of tuberculosis, which makes the infection of Mycobacterium tuberculosis difficult to control and tends to develop into refractory again. MDR is the main reason for the high mortality rate of tuberculosis. One of the reasons; the second is that the incidence of diseases caused by non-tuberculous mycobacteria (NTM) has increased, and people are paying more and more attention to it
Because the traditional detection method takes 6 to 8 weeks to get the result, the early treatment of the patient is delayed, and the patient is in a state of blind medication

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for identifying Mycobacterium tuberculosis and nontuberculous mycobacteria and application method thereof
  • Kit for identifying Mycobacterium tuberculosis and nontuberculous mycobacteria and application method thereof
  • Kit for identifying Mycobacterium tuberculosis and nontuberculous mycobacteria and application method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Embodiment 1 Mycobacterium extraction kit

[0048] Prepare 4% NaOH solution, 1.5mL sterile centrifuge tube and sterile tip. Collect clinical sputum samples, add an equal amount of phlegm-resolving reagent (4% NaOH), and fully shake the phlegm for 15-30 minutes until the sputum is completely liquefied. (Note: If the sputum sample is very thick and cheese-like, add twice the amount of expectorant reagent.)

[0049] a. Transfer 1.2mL of sputum sample digestion solution to a 1.5mL centrifuge tube, centrifuge at 12000 rpm for 5 minutes, and discard the supernatant.

[0050] b. Add 1mL M washing solution, mix well, centrifuge at 12000 rpm for 2 minutes, and discard the supernatant.

[0051] c. Add 50 μL M lysate, mix thoroughly, and cook in boiling water for 10 minutes.

[0052] d. Centrifuge at 12,000 rpm for 2 minutes, and the supernatant can be used as a PCR template.

Embodiment 2

[0054] The kit for differentiating Mycobacterium tuberculosis and non-tuberculosis Mycobacterium includes upstream primer MF1 and downstream primer MR1, designed probe M3 for detecting Mycobacterium, and designed probe T3 for detecting Mycobacterium tuberculosis.

[0055] Primer name

Primer sequence

MF1

tgttgggtcctgaggcaaca

MR1

atgctcgcaaccactaccca

[0056] Mycobacteria

probe name

probe sequence

Mycobacterium

M3

aacaccacaccccaccaccaagg

Mycobacterium tuberculosis

T3

ttgttccaggtgttgtcccaccgc

[0057] The 5' end of the probe M3 is labeled with HEX, the 5' end of the probe 2 is labeled with the fluorescent substance FAM, and the 3' ends of the probe 1 and the probe T3 are both labeled with the quenching substance BHQ.

[0058] The kit is as follows:

[0059] PCR reaction solution 750ul×1 tube;

[0060] positive standard

[0061] 1.0×10 7 copies / ml 50ul×1 tube;

[0062] 1.0×1...

Embodiment 3

[0087]

[0088]

[0089]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
separationaaaaaaaaaa
Login to View More

Abstract

The invention discloses a fluorescence quantitative nucleic acid detection technique for differentiating and identifying Mycobacterium tuberculosis and nontuberculous mycobacteria in one step based on the features of dual-channel fluorescence quantitative detection, which has a short detection time, provides reliable detection results and achieves the quantitative detection. The invention adopts the technical scheme as follows: a kit for identifying Mycobacterium tuberculosis and nontuberculous mycobacteria is provided, which comprises primers for PCR (polymerase chain reaction) amplification of strains to be detected and probes for fluorescence quantitative detection. According to the invention, according to the difference in gene sequence of different types of mycobacteria, the fluorescence probes are designed to differentiate Mycobacterium tuberculosis from nontuberculous mycobacteria; and the differentiation and identification is performed at the levels of gene sequence and molecular structure of bacterial strains, so as to ensue more accurate and more reliable classification. The invention solves the problem that in the conventional identification method, the differentiation based on the growth forms of bacterial strains needs a long period of time up to 4 to 6 weeks.

Description

technical field [0001] The invention relates to the field of detection of tuberculosis and non-tuberculosis mycobacteria, in particular to a method and a special kit for detecting tuberculosis and non-tuberculosis mycobacteria. Background technique [0002] Diseases caused by nontuberculous mycobacteria (NTM) other than Mycobacterium tuberculosis and Mycobacterium leprae are called nontuberculous mycobacteriosis and can involve lymph nodes, skin, soft tissues, and lungs. Nontuberculous mycobacteria infect the lungs, causing lung disease called nontuberculous mycobacterial pulmonary disease. Among them, there are more than 150 kinds of non-tuberculous mycobacteria (NTM) reported in the world, of which 54 kinds have been named, and there are 37 kinds of pathogenic mycobacteria, and more than 20 kinds have been isolated in China. [0003] NTM is an environmental mycobacterium, most of which are saprophytic bacteria, and mainly exist in the natural environment. It is now genera...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04G01N21/64
Inventor 邹耀东张新丽任维曲敬
Owner 亚能生物技术(深圳)有限公司