Kit for identifying Mycobacterium tuberculosis and nontuberculous mycobacteria and application method thereof
A technology for Mycobacterium tuberculosis and Mycobacterium tuberculosis, which is applied in biochemical equipment and methods, material stimulation analysis, and microbial determination/inspection, etc. and other problems, to achieve the effect of short detection time and accurate classification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Embodiment 1 Mycobacterium extraction kit
[0048] Prepare 4% NaOH solution, 1.5mL sterile centrifuge tube and sterile tip. Collect clinical sputum samples, add an equal amount of phlegm-resolving reagent (4% NaOH), and fully shake the phlegm for 15-30 minutes until the sputum is completely liquefied. (Note: If the sputum sample is very thick and cheese-like, add twice the amount of expectorant reagent.)
[0049] a. Transfer 1.2mL of sputum sample digestion solution to a 1.5mL centrifuge tube, centrifuge at 12000 rpm for 5 minutes, and discard the supernatant.
[0050] b. Add 1mL M washing solution, mix well, centrifuge at 12000 rpm for 2 minutes, and discard the supernatant.
[0051] c. Add 50 μL M lysate, mix thoroughly, and cook in boiling water for 10 minutes.
[0052] d. Centrifuge at 12,000 rpm for 2 minutes, and the supernatant can be used as a PCR template.
Embodiment 2
[0054] The kit for differentiating Mycobacterium tuberculosis and non-tuberculosis Mycobacterium includes upstream primer MF1 and downstream primer MR1, designed probe M3 for detecting Mycobacterium, and designed probe T3 for detecting Mycobacterium tuberculosis.
[0055] Primer name
Primer sequence
MF1
tgttgggtcctgaggcaaca
MR1
atgctcgcaaccactaccca
[0056] Mycobacteria
probe name
probe sequence
Mycobacterium
M3
aacaccacaccccaccaccaagg
Mycobacterium tuberculosis
T3
ttgttccaggtgttgtcccaccgc
[0057] The 5' end of the probe M3 is labeled with HEX, the 5' end of the probe 2 is labeled with the fluorescent substance FAM, and the 3' ends of the probe 1 and the probe T3 are both labeled with the quenching substance BHQ.
[0058] The kit is as follows:
[0059] PCR reaction solution 750ul×1 tube;
[0060] positive standard
[0061] 1.0×10 7 copies / ml 50ul×1 tube;
[0062] 1.0×1...
Embodiment 3
[0087]
[0088]
[0089]
PUM
| Property | Measurement | Unit |
|---|---|---|
| separation | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 