Primers, probes, methods and kits for detecting Campylobacter coli

A technology for the detection of Campylobacter coli, which is applied in the field of molecular biology, can solve the problems of harsh culture conditions, low detection sensitivity, and low detection rate, and achieve the effects of shortening the detection cycle, high detection sensitivity, and increasing the positive rate

Inactive Publication Date: 2011-12-07
ICDC CHINA CDC
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since Campylobacter coli is a microaerophilic bacterium, its growth requires a specific gas environment. The in vitro culture has high requirements on the nutritional conditions of the culture medium, the culture conditions are harsh, and the cost is high. The conventional biochemical identification of Campylobacter Possess good technology and experience, and due to the poor consistency of biochemical identification results for differentiating strains, it may lead to misidentification of isolated strains, resulting in low detection sensitivity of Campylobacter coli in diarrhea patients and food contamination detection. , the detection rate is not high, and the detection time is slow

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers, probes, methods and kits for detecting Campylobacter coli
  • Primers, probes, methods and kits for detecting Campylobacter coli
  • Primers, probes, methods and kits for detecting Campylobacter coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Determination of the specific DNA sequence of Campylobacter coli

[0041]The present invention uses BLASTn and Vector NTI Suite 6.0 software to compare the conservation of DNA sequences of all Campylobacter coli sequencing genes published by NCBI, and screens out the specific sequence of Campylobacter coli genes, the nucleotide sequence of which is as SEQ ID Shown in NO.1.

Embodiment 2

[0042] The design of embodiment 2 campylobacter coli specific primers and probe

[0043] When designing primers and probes in the present invention, attention should be paid to avoiding the mutation point of the sequence. After repeated screening and verification, a pair of fluorescent quantitative PCR primers for detecting Campylobacter coli and the TaqMan® primers used in conjunction with the primers were obtained using Primer Express Version 3 software. A probe, the probe is 5' labeled with a fluorescent group FAM, and 3' labeled with a quencher group BHQ.

[0044] The preferred primer sequence is,

[0045] Upstream primer: CTCGCTTTGGAATCATTCATG, Tm: 57°C,

[0046] Downstream primer: CTTTATTGCCCACAATGATATTTC, Tm: 56°C,

[0047] The preferred probe sequence is,

[0048] FAM-AGGAATCAATGCTGTGGATGAAAATGTAA-BHQ1, Tm: 64°C.

Embodiment 3

[0049] Example 3 Establishment of a fluorescent quantitative PCR detection method for detecting Campylobacter coli

[0050] (1) Optimization of real-time PCR experiment parameters

[0051] Refer to Invirogen recommended fluorescent quantitative PCR 25μL system: 2×PCR UDG12.5μL, mg 2+ 4.5mM, PCR nucleotide MIX (including dNTP) 4mM, final concentration of upstream and downstream primers is 0.4μM, final concentration of probe is 0.2μM, DNA template 2μL. Optimize one condition and fix the rest. The optimal conditions were judged according to the Ct value and the strength of the fluorescent signal, and the best conditions were combined as the final optimized system.

[0052] The annealing temperature was optimized from 55°C to 65°C; the primer was optimized according to the final concentration from 0.08μM to 0.62μM; the concentration of the probe was optimized from 0.08μM to 0.36μM; mg 2+ The concentration was optimized between 1.5-5mM; the concentration of dNTPs was optimized b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides real-time fluorescence quantitative PCR (Polymerase Chain Reaction) primers and probe for detecting campylobacter coli. The sequences of the primers and probe are respectively shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4. The invention also provides a method for carrying out fluorescence quantitative PCR detection on campylobacter coli by using the primers and probe, and a kit for detecting campylobacter coli. The detection method and the kit for detecting campylobacter coli provided by the invention have the advantages of accurate detection, high sensitivity, strong specificity, simplicity, convenience, quickness and good clinical specimen detection capability.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to fluorescent quantitative PCR primers and probes for detecting Campylobacter coli, and also relates to a method and a kit for detecting Campylobacter coli using the primers and probes. Background technique [0002] Campylobacter coli is one of the food-borne pathogens in Campylobacter genus that mainly cause human diseases, and it is the main pathogen that causes human diarrhea. Campylobacter coli is widely distributed, and human infection is mainly caused by the contamination of food, drinking water and the environment by Campylobacter coli, which brings serious disease burden to humans. The monitoring of Campylobacter coli is very concerned at home and abroad. [0003] Bacterial isolation, culture and biochemical identification are commonly used methods to detect Campylobacter coli infection. Since Campylobacter coli is a microaerophilic bacterium, its growth requires a specif...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11G01N21/64
CPCY02A50/30
Inventor张茂俊张建中乔博顾一心何利华
OwnerICDC CHINA CDC