Method for screening pig disease resistant breeds, and application thereof
An anti-virus, porcine genome technology, applied in the field of molecular genetics, can solve problems such as overinfection, loss of natural immunity of influenza virus, and rapid death
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1 Pig Mx1 Cloning, sequencing and mutation site analysis of the 5′ regulatory region sequence
[0028] Genome extraction: Pig ear tissue was taken, and genomic DNA was extracted according to the instructions of the TIANamp genomic DNA (Tiangen) kit.
[0029] According to NCBI (NCBI Reference Sequence: NC_010455.3), the following primers were designed, Mx1 The AF gene sequence is shown in Seq ID No:3, Mx1 The sequence of the AR gene is shown in Seq ID No:4, which covers the range from 18 bp downstream of the transcription start site to 2453 bp upstream, so as to obtain the full length of the sequence and perform sequence comparison to find differences in regulatory sequences.
[0030] Primer name Primer sequence Primer position Mx1 AF CTCTCCAAATGTCCACGACTTCTT -2453 Mx1 AR CTGTTCTCCCACACTTACTTGAAATCA +18
[0031] Prepare the PCR reaction solution according to the following system
[0032]
[0033] 2 x Prime STAR T...
Embodiment 2
[0064] Example 2 Pig Mx1 Effects of Mutations in the 5′ Regulatory Region on Initiating Activity
[0065] According to the genotyping results, genotype A and genotype B were used as templates, and the amplified products were mixed with 6×Loading buffer and loaded onto 0.5% TAE agarose gel, electrophoresed at 5V / cm for 20min, and then recovered by cutting the gel The 2.5kb fragment was purified according to the purification instructions of the Axygen Agarose Gel Purification Kit. The purified product was connected to the pGL-3 basic vector (Promega), cloned and transformed into DH5α, and a single colony was picked and sequenced. The sequence was correct and obtained Mx1 A promoter Luc and Mx1 B promoter Luc Two promoter reporter gene vectors. Inoculate the bacterial solution containing the correct insert into LB liquid medium containing 100 μg / ml ampicillin at a ratio of 1:500, and incubate vigorously at 200 rpm at 37°C for 14 hours. Collect the bacteria at 6000×g at ...
Embodiment 3
[0070] Example 3 Marker Assisted Breeding
[0071] According to attached figure 2 According to the genotype detection results of pigs, combined with the disease resistance characteristics of various pig species, the inventor detected the length polymorphism of the pig Mx1 5′ regulatory region by PCR, and inserted a 275bp fragment as a disease resistance-related gene marker, which would carry the disease resistance gene Marked pigs are bred, and after the piglets are born, the markers are identified, and pigs with strong disease resistance and excellent growth performance are screened out from them through comprehensive selection, so that excellent disease-resistant pig breeds can be established.
[0072]
[0073]
[0074]
[0075]
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com