Unlock instant, AI-driven research and patent intelligence for your innovation.

Construction and application of anti-hepatic fibrosis drug high-throughput screening cell model

An anti-hepatic fibrosis, high-throughput technology, applied in the assay/inspection of cells, microorganisms, and biological tests modified by the introduction of foreign genetic material to achieve high reliability and adaptability

Inactive Publication Date: 2014-12-24
MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
View PDF1 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The construction and application of the high-throughput screening model for anti-hepatic fibrosis drugs described in the present invention have not been reported at home and abroad so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and application of anti-hepatic fibrosis drug high-throughput screening cell model
  • Construction and application of anti-hepatic fibrosis drug high-throughput screening cell model
  • Construction and application of anti-hepatic fibrosis drug high-throughput screening cell model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Construction of "Example 1" pGL4.17-COL1A1P recombinant plasmid

[0034] Genomic DNA of LX2 cells was extracted using a genomic DNA extraction kit. The first about 2400 bp of the COL1A1 sequence (sequence number: NC_000017.11) of the human whole genome information of the NCBI database human type I collagen α1 gene COL1A1 was used as the COL1A1 promoter sequence. Primer Premier 5.0 was used to design primers for the COL1A1 promoter. The sequences of the upstream and downstream primers were 5'AAGAGCTCGTGGGAAAGCCTGGATGG3' (including the SacⅠ restriction site), and 5'AAAGATCTTTTGGGACTTACTGTCTTCGT3' (including the BglⅡ restriction site). Using the genomic DNA of LX2 cells as a template, PCR amplification was carried out to obtain the target fragment type Ⅰ collagen α1 gene COL1A1 promoter, and the PCR product was initially identified by agarose gel electrophoresis.

[0035] The type I collagen α1 gene COL1A1 promoter fragment was ligated with the pGL4.17[luc2 / Neo] vector af...

Embodiment 2

[0037] "Example 2" screening of monoclonal cell line LX2-COL

[0038] 1. TGF-β1 enhanced COL1A1 promoter activity detection

[0039] LX2 cells (Mount Sinai School of Medicine) were cultured in DMEM (Gibco) medium containing 10% fetal bovine serum at 37°C and 5% CO2. According to each well 5×10 4 Cells were plated on a 48-well plate, cultured for 24 hours, and transiently transfected for 6 hours with the method recommended by the transfection reagent lipofectamine2000 (Invitrogen), wherein the transfection amount of the plasmid pGL4.17-COL1A1P was 100 ng per well, and the internal reference plasmid Renilla was 30 ng per well. Plasmids: liposomes are 1 (μg): 2 or 2.5 (μl), and each experiment set up 3 replicate wells. After TGF-β1 (2ng·mL -1 , R&D Systems)) after 24h induction, the dual luciferase reporter gene detection system ( Reporter Assay System, Promega) detects the fluorescence intensity. Add 65 μl of 1× cell lysate (PLB) to each well, shake at room temperature for...

Embodiment 3

[0042] "Example 3" anti-hepatic fibrosis drug screening and compound activity identification

[0043] 1. Single luciferase reporter gene detection system to screen candidate compounds

[0044] The LX2-COL monoclonal cells were divided into 2×10 per well 4 Cells were plated in a 96-well plate, cultured without serum after the confluence of the cells was about 90%-95%, and TGF-β1 (2ng·mL -1 ) induction, while adding candidate compounds S1-S7 (80μg·mL -1 ), and the compound epigallocatechin gallate EGCG was used as the positive control drug, and 3 replicate wells were set for each group of experiments. After 24 hours of action, the original medium was discarded, and 50 μl / well of any medium was added. Add luciferase substrate (Bright-Glo TM Luciferase Assay System, Promega) 50 μl / hole, and the cell was lysed for 2 min before detection ( Figure 5 ). The results showed that after the compound S7 was added, the fluorescence of the LX2-COL cell line was the weakest, that is, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a high-throughput screening system constructed by taking I type collagen alpha1 gene COL1A1 promoter activity as a target spot on the basis of the characteristic that I type collagen alpha1 is highly expressed in a hepatic fibrosis process. By constructing an I type collagen alpha1 gene COL1A1 promoter fragment and pGL4.17 expression vector recombinant plasmid, transfecting a human hepatic satellite cell line (LX2) and screening by taking COL1A1 promoter activity detected by virtue of luciferase expression strength of a carrier pGL4.17 as index to obtain a stable monoclonal cell strain LX2-COL, and screening compounds S1-S7 by applying the cell strain LX2-COL to obtain a compound S7 with an obvious inhibiting effect on the COL1A1 promoter activity. mRNA real-time PCR and Western blotting analysis respectively show that the compound S7 can obviously reduce expression of the I type collagen alpha1 in transcription and protein levels and is hopeful to become a candidate anti-hepatic fibrosis drug; and the mRNA real-time PCR and Western blotting analysis also respectively show that the constructed system can be applied to anti-hepatic fibrosis drug high-throughput screening.

Description

Technical field: [0001] The invention relates to a cell model screening system for anti-hepatic fibrosis drugs, in particular to a high-throughput screening system for anti-fibrosis drugs based on the activity of promoters related to liver fibrosis genes. Background technique: [0002] Liver fibrosis is a pathological process of excessive deposition of extracellular matrix in the liver, especially type I collagen α1. It is a repair response of the body to acute and chronic liver damage, and most chronic liver diseases are accompanied by liver fibrosis. The continued development of liver fibrosis will eventually lead to liver cirrhosis, which accounts for a large proportion of global morbidity and mortality, and ultimately can only rely on liver transplantation to continue life. Studies have shown that liver fibrosis can be reversed, so it is of great significance to study how to control the reversible pathological process of liver fibrosis for the treatment of liver fibrosi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12Q1/68C12Q1/66G01N33/68
Inventor 邵荣光赵双双何红伟王菊仙王玉成白晓光马艳李娜仁
Owner MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI