Chicken Eimeria tenella actin depolymerizing factor (ADF) recombinant bacillus calmette-guerin and preparation method thereof
A technology for recombining BCG and chicken coccidia, which is applied in the field of genetic engineering, can solve the problem that there is no ideal vaccine for chicken coccidia, and achieve strong immune protection, cost reduction, and good stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Preparation of coccidia recombinant BCG vaccine of the present invention
[0035] The present invention takes coccidia invasion-related gene ADF gene as an example to construct a shuttle expression vector and an integrated expression vector.
[0036] one, The preparation steps of the shuttle expression vector coccidian recombinant BCG vaccine:
[0037] Two pairs of specific primers were designed with reference to the DNA sequence of the ADF gene and the physical map of the shuttle expression vector pMV261, and restriction sites were introduced.
[0038] Upstream primer AD1: 5 AGCTGCAG ATG GCG AGC GGA ATG CCA GTC 3; the 5' end contains a PstI site;
[0039] Downstream primer AD: 5 GAATCGAT CTAATGGAGCACGCTTAGGTC 3; 5' end contains ClaI site.
[0040] Using cDNA as a template, the ADF gene was amplified by RT-PCR technology, and the amplified product was connected to the PMD18-T cloning vector, followed by PCR, enzyme digestion and sequencing identification, and...
Embodiment 2
[0047] The purposes of coccidia recombinant BCG vaccine of the present invention
[0048] 1. Application of Shuttle Expression Vector Coccidia Recombinant BCG Vaccine
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com