Application of lea-like gene in deinococcus radiodurans R1 to cultivating drought-resistant plants
A drought-resistant, genetic technology, applied in the direction of microbial-based methods, applications, genetic engineering, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1D
[0037] Expression of embodiment 1D.radiodurans R1lea-like gene (DR1172) sequence in Escherichia coli
[0038] Design a pair of PCR-specific primers based on the published sequence of the lea-like gene (DR1172) in the D. radiodurans R1 genome:
[0039] Up 5′ ATTA ACTAGT CGCAGCGTAGGCTCCTGACA 3
[0040] Down 5′ACGCCATATG ACTCAGTTCTTGCGGGTGTT 3
[0041] The target gene sequence was amplified from D. radiodurans R1 genomic DNA by PCR method. Reaction conditions: 94°C for 10 min, [94°C for 60 sec, 55°C for 30 sec, 72°C for 60 sec] 30 cycles, 72°C for 10 min. After the PCR product was recovered by gel, it was cloned on the vector pGEMT-easy, named pGEMT-lea, and verified by sequencing; then the lea-like gene (DR1172) with cohesive ends and the promoter groEL were obtained by SpeI / NdeI double digestion. The pRADZ3 vector, the lea-like gene (DR1172) was connected to the pRAD Z3 vector to construct the Escherichia coli expression vector pRADZ3-lea G, and the expression vector was tra...
Embodiment 2
[0043]Example 2 Drought resistance experiment of recombinant strain containing D.radiodurans R1lea-like gene (DR1172)
[0044] 1. Experimental method
[0045] 1. The 2 recombinant Escherichia coli obtained in Example 1 were respectively inoculated in 20 mL of LB liquid medium (containing Amp antibiotics), and after shaking the flask for overnight culture (37° C.), they were then transferred to 100 mL of LB liquid medium , try to keep the inoculum size consistent, and cultivate until the OD600 is about 0.5 (try to keep the OD600 value consistent).
[0046] 2. After centrifuging 10mL of the bacterial solution, shock it in an equal volume of 3M sorbitol solution for 2 hours, and immediately dilute each sample to 10 times with sterile deionized water. -4 , take 10 μL spots on the surface of LB solid medium, culture at 37°C for 16 hours, observe the colony formation and take pictures (3M sorbitol is a hypertonic solution, which can simulate drought stress).
[0047] 2. Experiment...
Embodiment 3
[0051] Example 3 Expression of lea-like gene (DR1172) in rapeseed and identification of drought resistance of transgenic plants
[0052] (1) Agrobacterium-mediated transformation of rapeseed experiment
[0053] 1. Preparation of competent Agrobacterium tumefaciens EHA105
[0054] 1) Pick a single colony and inoculate it in 5mL YEB liquid medium (containing rifampicin Rif 50mg / L), and culture overnight at 28°C with shaking at 250rpm;
[0055] 2) Take 2mL of bacterial liquid, add it to 50mL YEB liquid medium (containing Rif 50mg / L), and culture at 28°C and 250rpm until OD 600 About 0.6 or so;
[0056] 3) Transfer the bacterial solution to a 50mL sterile centrifuge tube, bathe in ice for 30min, and centrifuge at 5000×g for 5min;
[0057] 4) Discard the supernatant, use 2mL 20mM CaCl for precipitation 2 Resuspended, 100 μL each was dispensed into 1.5 mL centrifuge tubes, and stored in liquid nitrogen for later use.
[0058] 2. Transformation of recombinant plasmid DNA into Ag...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 