Applications of ssc-miR-374b-5p in preparation of drugs for reducing fat deposition and/or resisting fat-related diseases
A technology of ssc-mir-374b-5p, 1.ssc-mir-374b-5p is applied in the application field of medicine to achieve the effect of reducing fat deposition and having great value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1, Discovery of ssc-miRNA-374b-5p and its coding sequence
[0028] 1. Obtaining the nucleotide sequence of ssc-miRNA-374b-5p
[0029] ssc-miRNA-374b-5p sequence: 5'-AUAUAAUACAACCUG CUAAGUG-3' (SEQ ID NO. 1).
[0030] Coding sequence of ssc-miRNA-374b-5p: 5'-ATATAATACAACCTG CTAAGTG-3' (SEQ ID NO.2).
[0031] 2. Acquisition of ssc-miRNA-374b-5p precursor sequence
[0032] ssc-miRNA-374b-5p precursor sequence:
[0033] 5'-UCGGAUGGAUAUAAUACAACCUGCUAAGUGUCCUAGCACUUAUCAGGUUGUAUUAUCAUUGUCCGUGUCUAUGGCUCUCG-3' (SEQ ID NO. 3)
[0034] Sense strand encoding ssc-miRNA-374b-5p precursor sequence:
[0035] 5'-GATCCTCGGATGGATATAATACAACCTGCTAAGTGTCCTAGCACTTATCAGGTTGTATTATCATTGTCCGTGTCTATGGCTCTCGTTTTTTGGAAA-3' (SEQ ID NO. 5)
[0036] Antisense strand encoding ssc-miRNA-374b-5p precursor sequence:
[0037] 5'-AGCTTTTCCAAAAAACGAGAGCCATAGACACGGACAATGATAATACAACCTGATAAGTGCTAGGACACTTAGCAGGTTGTATTATATCCATCCGAG-3' (SEQ ID NO. 6)
[0038] A randomly synthesized nucleotide sequence...
Embodiment 2
[0043] Embodiment 2, construction of ssc-miRNA-374b-5p expression vector
[0044] The sense strand and antisense strand of the precursor sequence encoding ssc-miRNA-374b-5p are annealed by drop-down PCR (the reaction system is as follows), and after the sequence is annealed, a cohesive end connected to the carrier can be formed, and the annealed sequence is linked to A recombinant plasmid is formed on the pSilencer 3.0-H1siRNA expression vector, and the recombinant plasmid is resistant to ampicillin. Escherichia coli DH5α competent cells (purchased from Promega) were transformed with recombinant plasmids, spread on LB plates containing ampicillin, picked up positive clones after being inverted at 37°C for 12 hours, and submitted to PCR for sequencing. Sequencing results showed that the recombinant plasmid carrying the target fragment SEQ ID NO.5 was named as recombinant plasmid A.
[0045] Drop-down PCR reaction system:
[0046]
[0047] Landing PCR reaction procedure:
...
Embodiment 3
[0051] Construction of embodiment 3, C / EBP-β3-UTR (recombinant plasmid D)
[0052] 1. According to the C / EBP-β gene (GenBank accession: NM005194), the primer sequence containing the Xbal restriction site was designed: the upstream primer sequence: GCTCTAGACGGAACTTGTTCAAGCAGC (SEQ ID NO.9); the downstream primer sequence: GCTCTAGA CAGAAACAACCCCGTAGGA (SEQ ID NO.10 ), the template is the genomic DNA of pigs, and the PCR amplification C / EBP-β gene is from 5' 1312 to 1701 nucleotide sequence and cloned into the Xbal enzyme cutting position downstream of the luciferase gene in the pGL3-Control vector (Ambion company) point, the recombinant plasmid D was obtained.
[0053] 2. The inhibitory effect of ssc-miRNA-374b-5p sequence on the expression of C / EBP-β gene, an important transcription factor for adipocyte differentiation. Treatment 1: Cell flasks were spread with Hela 229 cells (purchased from Shanghai Collection Cell Center of China Cell Bank), and the cells When the fusion rea...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com