Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Applications of ssc-miR-374b-5p in preparation of drugs for reducing fat deposition and/or resisting fat-related diseases

A technology of ssc-mir-374b-5p, 1.ssc-mir-374b-5p is applied in the application field of medicine to achieve the effect of reducing fat deposition and having great value

Inactive Publication Date: 2012-07-25
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no literature report that microRNA-374b can regulate fat metabolism.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Applications of ssc-miR-374b-5p in preparation of drugs for reducing fat deposition and/or resisting fat-related diseases
  • Applications of ssc-miR-374b-5p in preparation of drugs for reducing fat deposition and/or resisting fat-related diseases
  • Applications of ssc-miR-374b-5p in preparation of drugs for reducing fat deposition and/or resisting fat-related diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1, Discovery of ssc-miRNA-374b-5p and its coding sequence

[0028] 1. Obtaining the nucleotide sequence of ssc-miRNA-374b-5p

[0029] ssc-miRNA-374b-5p sequence: 5'-AUAUAAUACAACCUG CUAAGUG-3' (SEQ ID NO. 1).

[0030] Coding sequence of ssc-miRNA-374b-5p: 5'-ATATAATACAACCTG CTAAGTG-3' (SEQ ID NO.2).

[0031] 2. Acquisition of ssc-miRNA-374b-5p precursor sequence

[0032] ssc-miRNA-374b-5p precursor sequence:

[0033] 5'-UCGGAUGGAUAUAAUACAACCUGCUAAGUGUCCUAGCACUUAUCAGGUUGUAUUAUCAUUGUCCGUGUCUAUGGCUCUCG-3' (SEQ ID NO. 3)

[0034] Sense strand encoding ssc-miRNA-374b-5p precursor sequence:

[0035] 5'-GATCCTCGGATGGATATAATACAACCTGCTAAGTGTCCTAGCACTTATCAGGTTGTATTATCATTGTCCGTGTCTATGGCTCTCGTTTTTTGGAAA-3' (SEQ ID NO. 5)

[0036] Antisense strand encoding ssc-miRNA-374b-5p precursor sequence:

[0037] 5'-AGCTTTTCCAAAAAACGAGAGCCATAGACACGGACAATGATAATACAACCTGATAAGTGCTAGGACACTTAGCAGGTTGTATTATATCCATCCGAG-3' (SEQ ID NO. 6)

[0038] A randomly synthesized nucleotide sequence...

Embodiment 2

[0043] Embodiment 2, construction of ssc-miRNA-374b-5p expression vector

[0044] The sense strand and antisense strand of the precursor sequence encoding ssc-miRNA-374b-5p are annealed by drop-down PCR (the reaction system is as follows), and after the sequence is annealed, a cohesive end connected to the carrier can be formed, and the annealed sequence is linked to A recombinant plasmid is formed on the pSilencer 3.0-H1siRNA expression vector, and the recombinant plasmid is resistant to ampicillin. Escherichia coli DH5α competent cells (purchased from Promega) were transformed with recombinant plasmids, spread on LB plates containing ampicillin, picked up positive clones after being inverted at 37°C for 12 hours, and submitted to PCR for sequencing. Sequencing results showed that the recombinant plasmid carrying the target fragment SEQ ID NO.5 was named as recombinant plasmid A.

[0045] Drop-down PCR reaction system:

[0046]

[0047] Landing PCR reaction procedure:

...

Embodiment 3

[0051] Construction of embodiment 3, C / EBP-β3-UTR (recombinant plasmid D)

[0052] 1. According to the C / EBP-β gene (GenBank accession: NM005194), the primer sequence containing the Xbal restriction site was designed: the upstream primer sequence: GCTCTAGACGGAACTTGTTCAAGCAGC (SEQ ID NO.9); the downstream primer sequence: GCTCTAGA CAGAAACAACCCCGTAGGA (SEQ ID NO.10 ), the template is the genomic DNA of pigs, and the PCR amplification C / EBP-β gene is from 5' 1312 to 1701 nucleotide sequence and cloned into the Xbal enzyme cutting position downstream of the luciferase gene in the pGL3-Control vector (Ambion company) point, the recombinant plasmid D was obtained.

[0053] 2. The inhibitory effect of ssc-miRNA-374b-5p sequence on the expression of C / EBP-β gene, an important transcription factor for adipocyte differentiation. Treatment 1: Cell flasks were spread with Hela 229 cells (purchased from Shanghai Collection Cell Center of China Cell Bank), and the cells When the fusion rea...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biological medicine and relates to applications of ssc-miR-374b-5p in preparation of drugs for reducing fat deposition and / or resisting fat-related diseases. For the first time, according to the invention, ssc-miR-374b-5p is discovered to be able to effectively bind with a transcription product mRNA of a C / EBP-beta encoding gene that is an important transcription factor for adipocyte differentiation, and inhibit activity of a luciferase reporter gene with C / EBP-beta3-UTR. Cellular level experimental results show that the microRNA can bind with C / EBP-beta3-UTR so as to inhibit protein translation of C / EBP-beta, providing experimental basis for reduction of the fat deposition and control of the fat-related diseases. The microRNA provided by the invention is expected to be used as a novel antiobesity-related drug, and has significant values.

Description

technical field [0001] The invention relates to the field of biomedicine, and relates to the application of ssc-miR-374b-5p in the preparation of drugs for reducing fat deposition and / or resisting obesity-related diseases. technical background [0002] Overweight and obesity are a rapidly growing health problem worldwide in recent years. When body fat accumulates excessively and / or distributes abnormally, weight gain just easily causes obesity (obesity), it is the chronic metabolic disease that is caused by genetic environment and other factors. According to WHO estimates, there are currently more than 400 million obese patients worldwide, and 1.6 billion overweight people, and it is expected that this number will double by 2015. At least 2.6 million people die each year from obesity. Studies by Padwal et al. (2003) and Drew et al. (2007) have shown that obesity can lead to cardiovascular disease, hypertension, hyperlipidemia, diabetes and other diseases, and is closely re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K48/00C12N15/63A61P3/04A61P3/06
Inventor 杨晓静潘士锋赵茹茜孙钦伟马文强
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com