Unlock instant, AI-driven research and patent intelligence for your innovation.

Method and application for utilizing glutathione to separate hapten in mixed liquor

A glutathione and hapten technology, applied in the field of pharmacy, can solve the problems of difficult separation of haptens and small molecular weight of haptens, and achieve the effect of short time consumption, saving time and financial resources, and simple and easy method

Inactive Publication Date: 2012-07-25
SOUTHEAST UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The hapten has a small molecular weight and can only form a complete antigen when combined with macromolecular substances in the body such as proteins. It is difficult to separate haptens by conventional antigen separation methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and application for utilizing glutathione to separate hapten in mixed liquor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] 1. Prepare an affinity chromatography column immobilized with glutathione S-transferase, use the His-Tag of recombinant glutathione S-transferase to connect to the nickel chromatography column, and prepare it to perform specificity with glutathione Combined GST affinity chromatography column, the specific steps are as follows:

[0017] (1) The pGEX4T1 plasmid was collected according to the method of a commercial kit (B-type plasmid small-scale rapid extraction kit, Beijing Biotech), and the DNA sequence of glutathione S-transferase in the plasmid was amplified by PCR;

[0018] The forward primer sequence is GGAGGATCCGTATTCATGTCCCCTATACTAGGT,

[0019] The reverse primer sequence was GGACTCGAGAACCAGATCCGATTTTGGAGGATGGT.

[0020] The PCR reaction system is as follows: 5.0 μl of 10×PCR buffer, 5.0 μl of 25mMMgCl 2 , 4.0 μl dNTP (10 mM) mixture, 1.0 μl pGEX4T1 plasmid, 2.0 μl forward and reverse primer mix, 37.5 μl ddH 2 O and 0.5 μl Taq enzyme (5 units / μl). The reaction...

Embodiment 2

[0031] The invention can also be used for the separation of the hapten components in the traditional Chinese medicine injection, and can be further used for the distinction and identification of the hapten. The mixed liquid of this embodiment adopts Shuanghuanglian injection, and its main components are extracts of honeysuckle, scutellaria baicalensis and forsythia.

[0032] The method for preparing an affinity chromatography column immobilized with glutathione S-transferase is as shown in Example 1, then filter the Shuanghuanglian injection with a protein filter device, collect the filtrate, and make a lyophilized powder, which is used for every gram of the lyophilized powder. 10~20ml ddH 2 After O is dissolved, add reduced glutathione solution to make the final concentration 100 μM, mix well, and then place in a constant temperature water bath at 37°C for 40-50 minutes of reaction. Repeated passage through a purification column immobilized with glutathione S-transferase. R...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and an application for utilizing glutathione to separate hapten in mixed liquor. The method comprises the following steps of: preparing an affinity chromatography column fixed with glutathione S transferring enzyme; adding a reduced glutathione solution into the mixed liquor; after mixing uniformly, performing constant temperature water bath; repeatedly passing through the affinity chromatography column; washing the affinity chromatography column with concentrated glutathione solution so as to wash out the hapten compound combined with the glutathione S transferring enzyme; separating redundant glutathione in the eluent; and utilizing a high performance liquid chromatography to obtain each single component of the glutathione-hapten compound. According to the method provided by the invention, a large quantity of potential hapten components are quickly separated and obtained; the method is simple and is easily performed; the consumed time is short; the time and financial resource are efficiently saved; and a powerful technical support is provided for the subsequent hapten analysis.

Description

technical field [0001] The invention relates to the field of pharmacy, in particular to a method and application of using glutathione to separate haptens in a mixture. Background technique [0002] Traditional Chinese medicine injection is derived from classic prescriptions of traditional Chinese medicine, which plays an important role in the treatment of diseases and is widely used clinically. However, the allergic reaction caused by traditional Chinese medicine injection restricts its further development. The reasons for allergic reactions are: Chinese medicine injections have complex components, unstable quality, macromolecular substances such as vegetable protein, tannic acid, etc., and a large number of hapten components. Among them, macromolecular substances can be removed by ultrafiltration and molecular sieves, but there are many unknown haptens in addition to a few known small molecule haptens in traditional Chinese medicine injections, such as berberine, theophylli...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): B01D15/10B01J20/26
Inventor 易宏伟
Owner SOUTHEAST UNIV