Method and application for utilizing glutathione to separate hapten in mixed liquor
A glutathione and hapten technology, applied in the field of pharmacy, can solve the problems of difficult separation of haptens and small molecular weight of haptens, and achieve the effect of short time consumption, saving time and financial resources, and simple and easy method
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0016] 1. Prepare an affinity chromatography column immobilized with glutathione S-transferase, use the His-Tag of recombinant glutathione S-transferase to connect to the nickel chromatography column, and prepare it to perform specificity with glutathione Combined GST affinity chromatography column, the specific steps are as follows:
[0017] (1) The pGEX4T1 plasmid was collected according to the method of a commercial kit (B-type plasmid small-scale rapid extraction kit, Beijing Biotech), and the DNA sequence of glutathione S-transferase in the plasmid was amplified by PCR;
[0018] The forward primer sequence is GGAGGATCCGTATTCATGTCCCCTATACTAGGT,
[0019] The reverse primer sequence was GGACTCGAGAACCAGATCCGATTTTGGAGGATGGT.
[0020] The PCR reaction system is as follows: 5.0 μl of 10×PCR buffer, 5.0 μl of 25mMMgCl 2 , 4.0 μl dNTP (10 mM) mixture, 1.0 μl pGEX4T1 plasmid, 2.0 μl forward and reverse primer mix, 37.5 μl ddH 2 O and 0.5 μl Taq enzyme (5 units / μl). The reaction...
Embodiment 2
[0031] The invention can also be used for the separation of the hapten components in the traditional Chinese medicine injection, and can be further used for the distinction and identification of the hapten. The mixed liquid of this embodiment adopts Shuanghuanglian injection, and its main components are extracts of honeysuckle, scutellaria baicalensis and forsythia.
[0032] The method for preparing an affinity chromatography column immobilized with glutathione S-transferase is as shown in Example 1, then filter the Shuanghuanglian injection with a protein filter device, collect the filtrate, and make a lyophilized powder, which is used for every gram of the lyophilized powder. 10~20ml ddH 2 After O is dissolved, add reduced glutathione solution to make the final concentration 100 μM, mix well, and then place in a constant temperature water bath at 37°C for 40-50 minutes of reaction. Repeated passage through a purification column immobilized with glutathione S-transferase. R...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 