Supercharge Your Innovation With Domain-Expert AI Agents!

LAMP (Loop-Mediated Isothermal Amplification) assay kit for identifying virulent and avirulent strains of mycoplasma gallisepticum

A technology of Mycoplasma gallisepticum and attenuated strains, applied in the biological field, can solve the problems of long time consumption, low sensitivity, inability to determine the infection content of Mycoplasma gallisepticum and the like

Active Publication Date: 2012-07-25
GUANGXI VETERINARY RES INST
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these differential detection methods are time-consuming, low-sensitivity, and conventional PCR requires the use of a PCR machine and gel electrophoresis, which cannot determine the content of Mycoplasma gallisepticum infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP (Loop-Mediated Isothermal Amplification) assay kit for identifying virulent and avirulent strains of mycoplasma gallisepticum
  • LAMP (Loop-Mediated Isothermal Amplification) assay kit for identifying virulent and avirulent strains of mycoplasma gallisepticum
  • LAMP (Loop-Mediated Isothermal Amplification) assay kit for identifying virulent and avirulent strains of mycoplasma gallisepticum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0071] Embodiment 1, the design of primer and the preparation thereof kit

[0072] 1. Design of primers

[0073] According to the general gene conservation region (genbank: 335501-335700 nucleotides of CP001872.1) of strong and weak strains of Mycoplasma gallisepticum (MG) and the weak virus-specific gene conservation region (genbank: 603238- 603785 nucleotides), the following primers were designed:

[0074] The sequence of strong and weak toxic universal internal primer 1 is:

[0075] CCTTGTTACGACTTAACTCCAAATCAGTTGCTAACCGCAAGGAA (sequence 1),

[0076] The strong and weak toxic universal internal primer 2 sequence is:

[0077] AACGTGGGGGTGGATTACCTACCGTTATATGTAACAGGTGTA (sequence 2),

[0078] The sequence of strong and weak toxic universal outer primer 1 is: AGCTGGTAATATCTAAAAACCGT (sequence 3),

[0079] The sequence of strong and weak toxic universal outer primer 2 is: CTTGCTGGGTTTTAATTGTTTC (sequence 4),

[0080] The sequence of strong and weak toxic universal loop prim...

Embodiment 2

[0093] Example 2, the application of primers and kits thereof in the detection of strong and weak strains of Mycoplasma gallisepticum by LAMP

[0094] 4 virulent strains of MG (S6, A5969, K-2221(383T), K-1501-S) and 2 attenuated strains of MG (F2F10, K810) are described in the following reference 1; another virulent strain of MG Strain PG31 is described in reference 2 below;

[0095] MG attenuated vaccine strain (MG-F-vaccine) and chicken infectious laryngotracheitis virus (ILTV) were provided by China Veterinary Drug Administration; MG attenuated vaccine (MG-F-vaccine-Guangdong) was provided by Guangdong Yongshun Bioengineering Co., Ltd. ;

[0096]Records of Mycoplasma gallisynovii (MS-K1415), Mycoplasma turkey (MM-TACC), Mycoplasma Iowa (MI-I695), Newcastle disease virus (NDV-Lasota) and chicken infectious bronchitis virus (IBV Mass 41) In reference 3 below;

[0097] Avian influenza virus (AIV H9) is described in Reference 4 below.

[0098] References: [1] Han Wang, A.A....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an LAMP assay kit for identifying virulent and avirulent strains of mycoplasma gallisepticum. A primer group A provided by the LAMP assay kit consists of a primer group a and a primer group b; the primer group a consists of a primer 1 and a primer 2; the primer group b consists of a primer 3 and a primer 4; and the nucleotide sequences of the primer 1, the primer 2, the primer 3 and the primer 4 are sequence 1, sequence 2, sequence 3 and sequence 4 sequentially in a sequence table. An experiment for the LAMP assay kit proves that the primers and the method only need anordinary water bath rather other an expensive PCR (Polymerase Chain Reaction) instrument but have higher sensitivity than PCR assay, moreover, a result does not need to be observed by way of gel electrophoresis, and the LAMP assay kit is easy and rapid to operate, and is particularly suitable for field assay in grass roots.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a LAMP detection kit for identifying strong and weak strains of mycoplasma gallisepticum. Background technique [0002] Mycoplasma gallisepticum (MG) is the main pathogen of chronic respiratory diseases in chickens and other poultry. Infected chickens often have symptoms such as rales, cough, and runny nose, which can cause a decrease in chicken growth rate, a decrease in broiler carcass quality and Egg production rate, fertilization rate and hatching rate decline, etc., causing greater economic losses to the poultry industry. MG exists widely in all countries in the world, and the infection rate of MG in chicken flocks in my country is very high. Guo Rui et al. separated mycoplasma from 162 chickens suffering from respiratory diseases from 38 chicken farms in Hubei and Henan, and the result was 59 isolates. Was identified as Mycoplasma gallisepticum. Deng Xianwen et al. found in th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11C12R1/35
Inventor 谢芝勋罗思思谢丽基邓显文刘加波谢志勤庞耀珊范晴
Owner GUANGXI VETERINARY RES INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More