LAMP (Loop-Mediated Isothermal Amplification) assay kit for identifying virulent and avirulent strains of mycoplasma gallisepticum
A technology of Mycoplasma gallisepticum and attenuated strains, applied in the biological field, can solve the problems of long time consumption, low sensitivity, inability to determine the infection content of Mycoplasma gallisepticum and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0071] Embodiment 1, the design of primer and the preparation thereof kit
[0072] 1. Design of primers
[0073] According to the general gene conservation region (genbank: 335501-335700 nucleotides of CP001872.1) of strong and weak strains of Mycoplasma gallisepticum (MG) and the weak virus-specific gene conservation region (genbank: 603238- 603785 nucleotides), the following primers were designed:
[0074] The sequence of strong and weak toxic universal internal primer 1 is:
[0075] CCTTGTTACGACTTAACTCCAAATCAGTTGCTAACCGCAAGGAA (sequence 1),
[0076] The strong and weak toxic universal internal primer 2 sequence is:
[0077] AACGTGGGGGTGGATTACCTACCGTTATATGTAACAGGTGTA (sequence 2),
[0078] The sequence of strong and weak toxic universal outer primer 1 is: AGCTGGTAATATCTAAAAACCGT (sequence 3),
[0079] The sequence of strong and weak toxic universal outer primer 2 is: CTTGCTGGGTTTTAATTGTTTC (sequence 4),
[0080] The sequence of strong and weak toxic universal loop prim...
Embodiment 2
[0093] Example 2, the application of primers and kits thereof in the detection of strong and weak strains of Mycoplasma gallisepticum by LAMP
[0094] 4 virulent strains of MG (S6, A5969, K-2221(383T), K-1501-S) and 2 attenuated strains of MG (F2F10, K810) are described in the following reference 1; another virulent strain of MG Strain PG31 is described in reference 2 below;
[0095] MG attenuated vaccine strain (MG-F-vaccine) and chicken infectious laryngotracheitis virus (ILTV) were provided by China Veterinary Drug Administration; MG attenuated vaccine (MG-F-vaccine-Guangdong) was provided by Guangdong Yongshun Bioengineering Co., Ltd. ;
[0096]Records of Mycoplasma gallisynovii (MS-K1415), Mycoplasma turkey (MM-TACC), Mycoplasma Iowa (MI-I695), Newcastle disease virus (NDV-Lasota) and chicken infectious bronchitis virus (IBV Mass 41) In reference 3 below;
[0097] Avian influenza virus (AIV H9) is described in Reference 4 below.
[0098] References: [1] Han Wang, A.A....
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


