Supercharge Your Innovation With Domain-Expert AI Agents!

Fatty acid CoA ligase CCL2 of short-side chains of humulus lupulus, and coding gene and application of fatty acid CoA ligase CCL2

A gene and residue technology, applied in hop short side chain fatty acid CoA ligase CCL2 and its coding gene and application field, can solve the problem of no accumulation of pyrone compounds and achieve high specificity and wide application prospects Effect

Active Publication Date: 2012-08-01
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The corresponding gene (VPS gene) cloning and functional analysis have been completed, although the tissue specificity of VPS gene expression has a good correlation with the content trend of picric acid in different tissues, but the in vitro biochemical results show that VPS gene cannot catalyze the production of Expected aromatic ring products such as PIVP, but pyrone-like by-products, and no accumulation of pyrone-like compounds was found in the glandular trichomes of hops

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fatty acid CoA ligase CCL2 of short-side chains of humulus lupulus, and coding gene and application of fatty acid CoA ligase CCL2
  • Fatty acid CoA ligase CCL2 of short-side chains of humulus lupulus, and coding gene and application of fatty acid CoA ligase CCL2
  • Fatty acid CoA ligase CCL2 of short-side chains of humulus lupulus, and coding gene and application of fatty acid CoA ligase CCL2

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Embodiment 1, the discovery of CCL2 protein and its coding gene

[0056] An EST fragment was found from the specific EST library of hop gland glandular trichomes. This fragment has a high abundance in the library. Since compounds such as picric acid are also highly specifically accumulated in hop gland glandular trichomes, it is speculated that the EST fragment described Protein may be involved in the biosynthesis of picric acid.

[0057] The full-length sequence information of the gene in hops (cultivar: Nugget) was obtained using the 5' and 3' RACE methods (HlCCL2 3'RACE: GTGATCCCATCAGCATAAACTACACCTCAGGCACC; HlCCL2 5'RACE: GGTGCCTGAGGTGTAGTTTATGCTGATGGGATCAC).

[0058] A new protein (CCL2 protein) and its coding gene (CCL2 gene) were discovered by using the above steps. The CCL2 protein is shown in sequence 1 of the sequence listing. The open reading frame of the CCL2 gene is shown in sequence 2 of the sequence listing.

[0059] The real-time PCR method (CCL2-F: TG...

Embodiment 2

[0060] Embodiment 2, the preparation of PIVP standard substance

[0061] PIVP, the English full name is Phlorisovalerophenone, and the Chinese full name is isovaleryl phloroglucinol.

[0062] PIVP is an intermediate product in the picric acid production pathway in the glandular trichomes of hops. The related pathways are described in the literature: Nagel, J., Culley, L.K., Lu, Y.P., Liu, E.W., Matthews, P.D., Stevens, J.F.and Page, J.E. (2008) EST analysis of hop glandular trichomes identifies an O-methyltransferase that catalyzes the biosynthesis of xanthohumol. Plant Cell, 20, 186-200.

[0063] Prepare PIVP (Friedel-Crafts acylation reaction) as follows:

[0064] 1. With 2.3 grams of phloroglucinol (Phloroglucinol; purchased from Sigma, catalog number: 79330) and 2.2 grams of isovaleryl chloride (Isovaleryl chloride; purchased from Sigma, catalog number: 157422) as raw materials, in 4.4 ml of nitro Benzene (nitrobenzene; purchased from Sigma Company, catalog number: 72982...

Embodiment 3

[0068] Example 3, the application of CCL2 protein and its coding gene in the production of PIVP

[0069] 1. Construction of recombinant expression vector

[0070] 1. Construction of recombinant plasmid pESC-Leu-CCL2

[0071] (1) Synthesize the double-stranded DNA molecule shown in Sequence 2 of the Sequence Listing.

[0072] (2) Using the double-stranded DNA molecule synthesized in step (1) as a template, perform PCR amplification with a primer pair consisting of ESC(LEU)-CCL2-FOR and ESC(LEU)-CCL2-REV to obtain a PCR amplification product.

[0073] ESC(LEU)-CCL2-FOR: 5'- GCGGCCGC ATGGATAACTATAGAAGGCTCCACACTCCGG-3' (underlined Not I enzyme recognition sequence);

[0074] ESC(LEU)-CCL2-REV: 5'-TTAATTAATCAAGAAAGGCTGCCCATGGCCATTGC-3' (Pac I restriction recognition sequence is underlined).

[0075] (3) Using restriction endonucleases Not I and Pac I to double digest the PCR amplified product of step (2) to obtain a digested product.

[0076] (4) The pESC-Leu vector (purchase...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses fatty acid CoA ligase CCL2 of short-side chains of humulus lupulus, and a coding gene and application of the fatty acid CoA ligase CCL2. The protein, namely, the fatty acid CoA ligase CCL2 provided by the invention is from (Humulus lupulus L.), is named as CCL2 protein, and is the following (a) or (b), wherein (a) is the protein consisting of amino acid sequences shown in sequences 1 of a sequence table 1 shown as the specification; and (b) is the protein which is formed by substitution and / or deficiency and / or addition of one or more amino acid residue of amino acid sequences in the sequence 1, has the function of the fatty acid CoA ligase and is derived from the (a). The CCL2 protein provided by the invention has the action of the CoA ligase, is a necessary key factor for the path of picric acid synthesis, and can generate 2mg / L precursor phlorisovalerophenone (PIVP) for picric acid synthesis by coexpression of CCL2 and VPS (Valerophenone Synthase) genes in yeast. The fatty acid CoA ligase CCL2 disclosed by the invention has wide application prospect in the bear brewing industries and the fields of human health care and the like.

Description

technical field [0001] The invention relates to a hop short side chain fatty acid CoA ligase CCL2 and its coding gene and application. Background technique [0002] Hops (Humulus lupulus L.), also known as Humulus, hops, etc., are diploid (2n=2x=20) belonging to Rosaceae Cannabaceae Humulus hop species, is a perennial climbing herb, dioecious , the female flower is composed of bracts arranged in a tile-like arrangement to form a cone-shaped inflorescence, 3-4 cm long, with a large number of yellow glandular glandular hairs growing under the inner bracts. [0003] The female flowers of hops are mainly used in brewing beer, and are the main source of the characteristic aroma and bitterness of beer, and are generally considered to be the "green gold" of beer brewing. In 2009, the global beer sales volume was 470 billion US dollars. In 2008, China's beer market sales volume was about 100 billion RMB. The beer sales market is still expanding, both at home and abroad. Whether th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/00C12N15/52C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21C12P7/22C12P13/00C12P19/32
Inventor 王国栋张凤霞徐海洋
Owner INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More