Fatty acid CoA ligase CCL2 of short-side chains of humulus lupulus, and coding gene and application of fatty acid CoA ligase CCL2
A gene and residue technology, applied in hop short side chain fatty acid CoA ligase CCL2 and its coding gene and application field, can solve the problem of no accumulation of pyrone compounds and achieve high specificity and wide application prospects Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] Embodiment 1, the discovery of CCL2 protein and its coding gene
[0056] An EST fragment was found from the specific EST library of hop gland glandular trichomes. This fragment has a high abundance in the library. Since compounds such as picric acid are also highly specifically accumulated in hop gland glandular trichomes, it is speculated that the EST fragment described Protein may be involved in the biosynthesis of picric acid.
[0057] The full-length sequence information of the gene in hops (cultivar: Nugget) was obtained using the 5' and 3' RACE methods (HlCCL2 3'RACE: GTGATCCCATCAGCATAAACTACACCTCAGGCACC; HlCCL2 5'RACE: GGTGCCTGAGGTGTAGTTTATGCTGATGGGATCAC).
[0058] A new protein (CCL2 protein) and its coding gene (CCL2 gene) were discovered by using the above steps. The CCL2 protein is shown in sequence 1 of the sequence listing. The open reading frame of the CCL2 gene is shown in sequence 2 of the sequence listing.
[0059] The real-time PCR method (CCL2-F: TG...
Embodiment 2
[0060] Embodiment 2, the preparation of PIVP standard substance
[0061] PIVP, the English full name is Phlorisovalerophenone, and the Chinese full name is isovaleryl phloroglucinol.
[0062] PIVP is an intermediate product in the picric acid production pathway in the glandular trichomes of hops. The related pathways are described in the literature: Nagel, J., Culley, L.K., Lu, Y.P., Liu, E.W., Matthews, P.D., Stevens, J.F.and Page, J.E. (2008) EST analysis of hop glandular trichomes identifies an O-methyltransferase that catalyzes the biosynthesis of xanthohumol. Plant Cell, 20, 186-200.
[0063] Prepare PIVP (Friedel-Crafts acylation reaction) as follows:
[0064] 1. With 2.3 grams of phloroglucinol (Phloroglucinol; purchased from Sigma, catalog number: 79330) and 2.2 grams of isovaleryl chloride (Isovaleryl chloride; purchased from Sigma, catalog number: 157422) as raw materials, in 4.4 ml of nitro Benzene (nitrobenzene; purchased from Sigma Company, catalog number: 72982...
Embodiment 3
[0068] Example 3, the application of CCL2 protein and its coding gene in the production of PIVP
[0069] 1. Construction of recombinant expression vector
[0070] 1. Construction of recombinant plasmid pESC-Leu-CCL2
[0071] (1) Synthesize the double-stranded DNA molecule shown in Sequence 2 of the Sequence Listing.
[0072] (2) Using the double-stranded DNA molecule synthesized in step (1) as a template, perform PCR amplification with a primer pair consisting of ESC(LEU)-CCL2-FOR and ESC(LEU)-CCL2-REV to obtain a PCR amplification product.
[0073] ESC(LEU)-CCL2-FOR: 5'- GCGGCCGC ATGGATAACTATAGAAGGCTCCACACTCCGG-3' (underlined Not I enzyme recognition sequence);
[0074] ESC(LEU)-CCL2-REV: 5'-TTAATTAATCAAGAAAGGCTGCCCATGGCCATTGC-3' (Pac I restriction recognition sequence is underlined).
[0075] (3) Using restriction endonucleases Not I and Pac I to double digest the PCR amplified product of step (2) to obtain a digested product.
[0076] (4) The pESC-Leu vector (purchase...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 