LAMP (Loop-mediated isothermal amplification) detection primer set of transgenic soybeans GTS 40-3-2 as well as derived varieties thereof, kit and detection method

A technology of genetically modified soybeans and detection kits, applied in the field of molecular biology, to achieve the effects of simple operation, high sensitivity, and easy identification

Active Publication Date: 2013-08-07
广州迪澳生物科技有限公司 +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] Loop-Mediated Isothermal Amplification (Loop-Mediated Isothermal Amplification, hereinafter referred to as LAMP method) is a gene developed by Eiken Chemical Co., Ltd. in Japan around 2000 Amplification technology, which has the advantages of fast, simple, accurate operation, easy popularization, safety and reliability. At present, there is no kit that applies the LAMP method to the rapid detection of transgenic soybean GTS 40-3-2 and its derivatives

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP (Loop-mediated isothermal amplification) detection primer set of transgenic soybeans GTS 40-3-2 as well as derived varieties thereof, kit and detection method
  • LAMP (Loop-mediated isothermal amplification) detection primer set of transgenic soybeans GTS 40-3-2 as well as derived varieties thereof, kit and detection method
  • LAMP (Loop-mediated isothermal amplification) detection primer set of transgenic soybeans GTS 40-3-2 as well as derived varieties thereof, kit and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1 Kit containing chromogen and detection method thereof:

[0057] LAMP detection kit for transgenic soybean GTS 40-3-2 and its derivatives, including primer solution, reaction solution, DNA polymerase, control and chromogenic reagent:

[0058] (1) Primer solution: Contains 5 μM outer primer 1, 5 μM outer primer 2, 40 μM inner primer 1, 40 μM inner primer 2, the four primers are:

[0059] Outer primer 1: GCTTCAACATGTGAAGGAGTA (SEQ ID No: 1)

[0060] Outer primer 2: AACTACCTTCTCACCGCA (SEQ ID No: 2)

[0061] Inner primer 1: CAACGAGAAGCTATATGTAGATGCTCACTCACCAGTGACCCTA (SEQ ID No: 3)

[0062] Inner primer 2: CAAAACTATTTGGGATCGGAGAAGAGAACTTCTCGACGATGGC (SEQ ID No: 4)

[0063] (2) Reaction solution: Contains 10mM dNTP, 10×ThermoPol reaction buffer, 150mM MgSO4 aqueous solution, the volume ratio of the three is 8:5:2;

[0064] (3) DNA polymerase: Bst DNA polymerase, the concentration is 8U / μl;

[0065] (4) Control: The positive control is the DNA of transgenic s...

Embodiment 2

[0073] Embodiment 2 The kit and detection method thereof without chromogenic agent:

[0074] The kit is the same as that in Example 1 except that it lacks the chromogen in Example 1.

[0075] Use the above kit to detect the soybean variety to be tested in the following way:

[0076] (1) DNA extraction of the sample to be tested: the DNA of the sample to be tested is extracted and purified by the CTAB method;

[0077] (2) Constant temperature gene amplification reaction: prepare reaction system in 200ul PCR tube: primer solution 1μl, reaction solution 12.5μl, DNA polymerase 1μl, DNA to be tested 2μl, make up to 25μl with sterilized deionized water; set positive control During the reaction, the DNA of the transgenic soybean GTS 40-3-2 with a concentration of 5% or the Escherichia coli plasmid DNA containing the target gene was used to replace the DNA to be tested. Detect DNA; mix the prepared PCR tube and centrifuge, react at 65°C for 60 minutes, and continue at 80°C for 2 m...

Embodiment 3

[0081] Embodiment 3 PCR reaction and the comparison of detection method sensitivity of the present invention:

[0082] Prepare the LAMP detection kit of transgenic soybean GTS 40-3-2 and its derivative varieties according to the following formula:

[0083] (1) Primer solution: Contains 5 μM outer primer 1, 5 μM outer primer 2, 40 μM inner primer 1, 40 μM inner primer 2, the four primers are:

[0084] Outer primer 1: GCTTCAACATGTGAAGGAGTA (SEQ ID No.1)

[0085] Outer primer 2: AACTACCTTCTCACCGCA (SEQ ID No.2)

[0086] Inner primer 1: CAACGAGAAGCTATATGTAGATGCTCACTCACCAGTGACCCTA (SEQ ID No. 3)

[0087] Internal primer 2: CAAAACTATTTGGGATCGGAGAAGAGAACTTCTCGACGATGGC (SEQ ID No. 4)

[0088] (2) Reaction solution: Contains 10mM dNTP, 10×ThermoPol reaction buffer, 150mM MgSO4 aqueous solution, the volume ratio of the three is 8:5:2;

[0089] (3) DNA polymerase: Bst DNA polymerase, the concentration is 8U / μl;

[0090] (4) Control: The positive control is the DNA of transgenic so...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses transgenic soybeans GTS 40-3-2 and an LAMP (Loop-mediated isothermal amplification) detection primer set of derived varieties thereof, a detection kit and a detection method. The detection primer set comprises four specific primers; the detection kit comprises a primer solution, a reaction solution, a DNA (Deoxyribose Nucleic Acid) polymerase and a contrast; and the kit can further have a color developing agent. The detection method comprises the steps as follows: extracting DNAs of soybean varieties to be detected; amplifying sample DNA templates at a temperature of 63-65 DEG C by the four specific primers and the DNA polymerase with chain substitute activity, wherein the amplifying efficiency can reach 109-1010 copies in a short time and theamplifying process is judged whether to be carried out or not by a way of adding SYBRGreenI to observe color change or using a turbidity meter to observe turbidity change of deposits in a reaction tube; and determining if the soybean varieties to be detected contain the transgenic soybeans GTS 40-3-2 as well as the derived varieties thereof or are the transgenic soybeans GTS 40-3-2 as well as the derived varieties thereof. The invention has the advantages of quickness and high efficiency, easiness and convenience in operation, high specificity, high sensitivity, easiness and convenience in judgment, suitability for field detection and the like, and is suitable for popularization and application.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a detection method of a transgenic plant variety, in particular to a LAMP detection primer set, a detection kit and a detection method of the transgenic soybean GTS 40-3-2 and its derivative varieties. Background technique [0002] According to the report "2010 Global Biotech / GM Crops Commercialization Development Status" recently published by the International Agricultural Biotechnology Application Service, about 100 million farmers have made planting decisions in the past 15 years due to the huge benefits brought by genetically modified crops . In the 15 years since GM crops were commercially planted, the cumulative area of ​​GM crops in the world has exceeded 1 billion hectares. In 2010, 15.4 million farmers in 29 countries around the world planted a total of 148 million hectares of biotech crops. From 1996 to 2010, the global hectarage of biotech crops increased 87-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 常彦磊李志勇凌莉杨坚肖艳文石磊
Owner 广州迪澳生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap