Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Feruloyl esterase PCFAE2 deriving from phytophthora capsici leonian and coding gene and application of feruloyl esterase PCFAE2

A technology of Phytophthora capsicum and encoding gene, which can be applied in application, genetic engineering, plant genetic improvement and other directions, and can solve the problems of fast epidemic speed, short disease cycle, economic loss and the like

Inactive Publication Date: 2012-09-19
SHANDONG AGRICULTURAL UNIVERSITY
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Capsicum blight is a devastating disease with a wide distribution worldwide in the cultivation and production of peppers. The disease has a short onset period and a fast epidemic speed, which brings serious economic losses to production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Feruloyl esterase PCFAE2 deriving from phytophthora capsici leonian and coding gene and application of feruloyl esterase PCFAE2
  • Feruloyl esterase PCFAE2 deriving from phytophthora capsici leonian and coding gene and application of feruloyl esterase PCFAE2
  • Feruloyl esterase PCFAE2 deriving from phytophthora capsici leonian and coding gene and application of feruloyl esterase PCFAE2

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Embodiment 1, the cloning of ferulic esterase PCFAE2 gene and the pathogenicity of PCFAE2

[0066] 1. PCFAE2 gene cloning

[0067] Design of primers for cloning Phytophthora capsici ferulic acid esterase PCFAE2 gene:

[0068] 18721-FP: ATGAAAATCTCCTACGCACCCTTC; 18721-RP: TTATGGCTCCATCACGGGATTG.

[0069] Using the genomic DNA of Phytophthora capsici strain SD33 (Shandong Agricultural University) (J. Phytopathol 157:585-591, 2009) as a template, PCR amplification was carried out with the above primers, and the amplified products were recovered and combined with pGEM-T Easy Vector ( Promega) connection, and transformed into Escherichia coli DH5α, positive clones were screened through blue-white screening and enzyme digestion identification of plasmid DNA, and the plasmids of positive clones were extracted for sequencing. The sequencing results showed that the nucleotide sequence of the PCR product was listed in the sequence list. Sequence 1 encodes the protein Phytophtho...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a feruloyl esterase PCFAE2 deriving from phytophthora capsici leonian and a coding gene and application of the feruloyl esterase PCFAE2. The feruloyl esterase PCFAE2 is protein represented by a), b) or c): a) protein composed of amino acid sequences shown at positions of 21-569 of a second sequence in a sequence list; b) protein composed of amino acid sequences shown in the second sequence in the sequence list; and c) protein which is obtained by subjecting the amino acid sequences shown in the second sequence in the sequence list or the amino acid sequences shown at the positions of 21-569 of the second sequence to substitution and / or deletion and / or addition of one or several amino acid residues, is associated to pathogenicity of the phytophthora capsici leonian and derives from the a). The feruloyl esterase PCFAE2, the coding gene and the application lay a technical foundation for further development on phytophthora capsici leonian molecule detection technique and prevention and research of various plant diseases resulting from the phytophthora capsici leonian.

Description

technical field [0001] The invention relates to a ferulic acid esterase, its encoding gene and application, in particular to ferulic acid esterase PCFAE2 from Phytophthora capsici and its encoding gene and application. Background technique [0002] Phytophthora capsici Leonian belongs to the phylum Fungi, the subphylum Flagellate, the class Oomycetes, and the order Peronomycetes. Phytophthora capsici is a pathogenic fungus with a wide range of hosts, in addition to infecting peppers, it also infects other crops. Zhou Qiming et al. reported infecting 21 species of cultivated plants and weeds in 9 families; Ren Guangchi et al. found that the fungus can harm eggplant, cucumber, tomato, cowpea, kidney bean, cabbage, cabbage, radish, carrot, peach, apricot, apple, etc. It is weakly infective to onions and garlic, and does not infect citrus and potato stems and leaves. It is the most pathogenic to pepper. [0003] Pepper blight is a soil-borne disease caused by Phytophthora cap...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/18C12N15/55C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10C12N15/11C12Q1/68C12Q1/44A01N61/00A01P3/00
Inventor 张修国
Owner SHANDONG AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products