Feruloyl esterase PCFAE2 deriving from phytophthora capsici leonian and coding gene and application of feruloyl esterase PCFAE2
A technology of Phytophthora capsicum and encoding gene, which can be applied in application, genetic engineering, plant genetic improvement and other directions, and can solve the problems of fast epidemic speed, short disease cycle, economic loss and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0065] Embodiment 1, the cloning of ferulic esterase PCFAE2 gene and the pathogenicity of PCFAE2
[0066] 1. PCFAE2 gene cloning
[0067] Design of primers for cloning Phytophthora capsici ferulic acid esterase PCFAE2 gene:
[0068] 18721-FP: ATGAAAATCTCCTACGCACCCTTC; 18721-RP: TTATGGCTCCATCACGGGATTG.
[0069] Using the genomic DNA of Phytophthora capsici strain SD33 (Shandong Agricultural University) (J. Phytopathol 157:585-591, 2009) as a template, PCR amplification was carried out with the above primers, and the amplified products were recovered and combined with pGEM-T Easy Vector ( Promega) connection, and transformed into Escherichia coli DH5α, positive clones were screened through blue-white screening and enzyme digestion identification of plasmid DNA, and the plasmids of positive clones were extracted for sequencing. The sequencing results showed that the nucleotide sequence of the PCR product was listed in the sequence list. Sequence 1 encodes the protein Phytophtho...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com