Biosynthesis method for increasing accumulation of L-5-methyltetrahydrofolate

A technology of methyltetrahydrofolate and synthetase, which is applied in the field of metabolic engineering, can solve the problems of less research on the biosynthesis of L-5-methyltetrahydrofolate, improve the utilization rate of raw materials, reduce production costs and energy consumption Effect

Inactive Publication Date: 2012-11-14
CHINA PHARM UNIV
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are few studies on the biosynthesis of L-5-methyltetrahydrofolate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biosynthesis method for increasing accumulation of L-5-methyltetrahydrofolate
  • Biosynthesis method for increasing accumulation of L-5-methyltetrahydrofolate
  • Biosynthesis method for increasing accumulation of L-5-methyltetrahydrofolate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Construction of co-expression plasmids

[0041] 1.1 Primer design

[0042] According to the folA and metF sequences reported by NCBI, the following 4 primers were designed:

[0043] folAUP: GAGCTC GGGATAATGATCAGTCTGATTGCGGC

[0044] fol ADOWN: AAGCTT TTACCGCCGCTCCAGAATCTCAA

[0045] metFUP: GGATCC ATGAGCTTTTTTCACGCCAGCCAGCG

[0046] metFDOWN: GAGCTC TTATAAACCAGGTCGAACCCCCA

[0047] Among them, folAUP and folADOWN are used to amplify the folA coding region; metFUP and metFDOWN are used to amplify the metF coding region; the underlines on folAUP, folADOWN, metFUP, and metFDOWN represent the Sac I restriction enzymes introduced on folAUP, folADOWN, metFUP, and metFDOWN respectively site, Hind III restriction site, BamH I restriction site and Sac I restriction site.

[0048] 1.2 PCR amplification of folA and metF sequences

[0049] The genome of Escherichia coli E.coli BL21(DE3) was extracted.

[0050] Using the Escherichia coli E.coli BL21 (DE3) ...

Embodiment 2

[0069] Example 2 Transformation of Bacterial Strain Accumulating L-5-Methyltetrahydrofolate with Expression Plasmid

[0070] Plasmids pETfolAmetF, pETfolA, pETmetF and pET-28a(+) were respectively transformed into host bacteria E.coli BL21(DE3), respectively named PAF01, PA02, PF03 and P04, and coated with 20 μg / mL kanamycin Solid LB plates, cultivated at 37°C until the transformants grow out. Among them, E.coli BL21 (DE3) is a non-kanamycin-resistant strain and cannot grow on a solid LB plate containing kanamycin. Therefore, the transformants grown on the plate are transformed with pETfolAmetF, pETfolA, pETmetF and E. coli with pET-28a(+) plasmid.

[0071] Randomly pick the transformants of PAF01, PA02, PF03 and P04, shake the flask for fermentation culture, add inducer at an appropriate time, continue to culture for 3-8 hours, ultrasonically disrupt the cells, and perform SDS-PAGE on the soluble protein, the results are as follows: Figure 5 . according to Figure 5 Th...

Embodiment 3

[0074] Example 3 Fermentation of L-5-Methyltetrahydrofolate in PAF01, PA02, PF03 and E.coli RL21(DE3) Shake Flasks

[0075] Single colonies of PAF01, PA02, PF03 and E.coli BL21(DE3) (original bacteria, named BL21) grown overnight on solid LB plates at 37°C were respectively inserted into liquid LB medium and cultured in shake flasks overnight.

[0076] Take an appropriate amount of bacterial liquid and transfer it into the shake flask fermentation medium, and cultivate for 10 h. Among them, add the inducer at an appropriate time; add 0.05 g of precursor folic acid and 8% glycerol at an appropriate time, and take samples at 4h, 6h, 8h, and 10h of fermentation to detect the accumulation of L-5-methyltetrahydrofolate in the fermentation product, The test results are shown in Table 1.

[0077] According to the results in Table 1, the accumulation of L-5-methyltetrahydrofolate in PAF01, PA02, PF03, and BL21 reached the highest level at 10 h of fermentation, reaching about 11 ti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a biosynthesis method for increasing accumulation of L-5-methyltetrahydrofolate, and an L-5-methyltetrahydrofolate synthetase system co-expressed recombinant plasmid and a construction method and application thereof. The L-5-methyltetrahydrofolate synthetase system co-expressed recombinant plasmid comprises DHFR (dihydrofolate reductase) gene folA and a MTHFR (methylenetetrahydrofolate reductase) gene metF sequence. The biosynthesis method for increasing accumulation of L-5-methyltetrahydrofolate includes converting the L-5-methyltetrahydrofolate synthetase system co-expressed recombinant plasmid to accumulate an original strain of the L-5-methyltetrahydrofolate so as to obtain a recombinant strain, and fermenting the recombinant strain. The accumulation of the L-5-methyltetrahydrofolate in final fermentation product is evidently higher than that of the L-5-methyltetrahydrofolate in the original strain. Utilization rate of raw materials is increased, production cost and energy consumption are reduced, and a foundation for industrial biosynthesis of the L-5-methyltetrahydrofolate is laid.

Description

technical field [0001] The invention belongs to the technical field of metabolic engineering, and in particular relates to a biosynthetic method for increasing the accumulation of L-5-methyltetrahydrofolate. Background technique [0002] L-5-methyltetrahydrofolate is also known as (6S)-5-methyltetrahydrofolate, and its chemical name is (6S)-N-[4-[[(2-amino-1,4,5,6, 7,8-Hexahydro-4-oxo-5-methyl-6-pteridinyl)methyl]amino]benzoyl]-L-glutamic acid. [0003] L-5-Methyltetrahydrofolate is the most biologically active and functional form of folic acid, which plays an indispensable role in human life activities. Ordinary folic acid can participate in the methylation process and DNA synthesis only if it is converted into L-5-methyltetrahydrofolate. [0004] L-5-Methyltetrahydrofolate is an important methyl donor in the body and can participate in various biochemical reactions in the body. For example, L-5-methyltetrahydrofolate is the main form in the folic acid cycle, and it is a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/66C12N15/70C12N1/21C12R1/19
Inventor卞筱泓许激扬邵飞刘娅梅
OwnerCHINA PHARM UNIV