Check patentability & draft patents in minutes with Patsnap Eureka AI!

Cre fusion protein functional test cell and modified Cre fusion protein

A fusion protein and functional detection technology, which is applied in the direction of the introduction of foreign genetic material modified cells, microbial measurement/inspection, the use of vectors to introduce foreign genetic material, etc., can solve the failure of cell line establishment, affect the normal growth of cells, and affect the Cre Recombinase verification and other issues to achieve high transmembrane efficiency and good biological activity

Inactive Publication Date: 2012-12-19
NORTHWEST A & F UNIV +1
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this random integration (or other methods) may produce the following situations: 1. Insertion mutation: viral vector-mediated integration can easily lead to insertion mutation and cause cell line establishment failure; 2. Gene silencing: random integration of non-viral vectors also It is easy to integrate into the heterochromatin region, causing transgene silencing, so that the newly established cell line cannot normally express the reporter gene, and cannot normally indicate the cre cutting efficiency; 3. Non-single-copy integration: on the premise of excluding the previous two cases, it is assumed that The random integration sites of non-viral vectors are located in the transcriptional active region. If non-single-copy integration occurs, in addition to affecting the normal growth of cells, the redundant LoxP sequence will also affect the verification of Cre recombinase function.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cre fusion protein functional test cell and modified Cre fusion protein
  • Cre fusion protein functional test cell and modified Cre fusion protein
  • Cre fusion protein functional test cell and modified Cre fusion protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0032] The present invention will be further described in detail below in conjunction with specific embodiments, which are explanations of the present invention rather than limitations.

[0033] 1. Cre recombinase functional verification cell line 293-C31-L2GFP establishment and functional verification

[0034] 1.1 Construction of vector pACMV-stop-EGFP

[0035] The vector pACMV-stop-EGFP construction process used to establish a cell line for detecting cre recombinase activity is as follows:

[0036] Using the carrier pcdna3.1 (+) (Invitrogen Company) as a template, two sections of BGH terminator sequences were amplified by PCR method, one of which had fragment P1 with AscI and SpeI restriction sites, and its amplification primers were:

[0037] Upstream primer: TTGGCGCGCCACCCGCTGATCAG;

[0038] Downstream primer: CCGGACTAGTGGTTCTTTCCGCCTCAGAAGCC;

[0039] Another fragment P2 with SpeI and AflII restriction sites, its amplification primer is:

[0040] Upstream primer: GGAC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Cre fusion protein functional test cell and a modified Cre fusion protein. The Cre fusion protein functional test cell takes an HEK (human embryonic kidney) 293 cell as a host cell, a pAcmy (African cassava mosaic virus)-stop-EGFP (enhanced green fluorescent protein) carrier and phi C31 integrase are used for co-transfection of the host cell. Through the action of the phi C31 integrase, the carrier which carries an LoxP (locus of X-over P1) element having a Cre recombinase detection function is integrated to a pseudo attP (attachment P) site of an HEK 293 cell line in a single copying manner, so a stable and reliable cell model is provided for researching the Cre fusion protein membrane penetrating efficiency and biological activity. The Cre fusion protein HNTC (hemagglutinin-neuraminidase cytotoxic T) which is modified by TAT (transactivator) and NLS (nuclear localization signal) polypeptides has high membrane penetrating efficiency and good biological activity, can be effectively used as a tool for genetic manipulation at a mammalian cell chromosome level.

Description

technical field [0001] The invention belongs to the technical field of recombinant function detection cells, and relates to a Cre fusion protein function detection cell and a modified Cre fusion protein. Background technique [0002] Cre belongs to the recombinase family, which is derived from P1 phage and can act on mammalian cells to cause DNA sequence-specific recombination proteins (Nagy A: Cre recombinase: the universal reagent for genome tailoring. Genesis 2000,26:99-109), It is a 38kD protein encoded by P1 phage, which can recognize a 34bp loxp site. Recombinase has no strict requirements on the conformation of the substrate, which can be supercoiled DNA or linear DNA. Under the action of Cre enzyme, the DNA fragment between the two loxp sites in the same direction will be deleted; the DNA between the two reverse loxp sites will be flipped (Hoess R H, Abremski K. Mechanism of strand cleavage and exchange in the Cre lox site specific recombination system[J]. MolBiol,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N5/10C12Q1/48C12Q1/02C12N9/12C12N15/70
Inventor 余源张涌王勇胜刘军权富生田进海王易之李仲夏
Owner NORTHWEST A & F UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More