Method for building helicobacter pylori nucleic acid fingerprint spectrum and product thereof

A technology of Helicobacter pylori and fingerprints, which is applied in the direction of microorganism-based methods, biochemical equipment and methods, and microorganism measurement/inspection, which can solve problems such as retention and achieve high-sensitivity effects

Active Publication Date: 2012-12-19
BIOYONG TECH
View PDF5 Cites 34 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method still stays on the analysis of the characteristic protein of Helicobacter pylori, and does not involve how to establish a Helicobacter pylori-related nucleic acid mass spectrometry signature library and use the library for bacterial identification and typing, so it cannot solve the above problems

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for building helicobacter pylori nucleic acid fingerprint spectrum and product thereof
  • Method for building helicobacter pylori nucleic acid fingerprint spectrum and product thereof
  • Method for building helicobacter pylori nucleic acid fingerprint spectrum and product thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Example 1: Establishment of Helicobacter pylori nucleic acid fingerprint

[0063] 1. Design and select appropriate primers

[0064] According to the 16S gene sequence of Helicobacter pylori (Helicobacter pylori 26695), PCR primers were designed, respectively:

[0065] SEQ ID No: 1

5-aggaagagagAGAGTTTGATCCTGGCTCAG-3 (SEQ ID No: 1)

SEQ ID No: 2

5-cagtaatacgactcactatagggagaaggctCTGCTGCGTCCCGTAG-3 (SEQ ID No: 2)

[0066] The sequences AGAGTTTGATCCTGGCTCAG and CTGCTGCGTCCCGTAG respectively match the target region, aggaagagag and cagtaatacgactcactatagggagaaggct are additional sequences added on the upstream and downstream PCR primers to ensure that the 5' end of the primer of SEQ ID No: 1 contains a 10bp tag (aggaagagag ), the 5' end of the primer of SEQ ID No: 2 contains a 31bp tag (cagtaatacgactcactatagggagaaggct).

[0067] Relevant primers were synthesized at Sangon Bioengineering (Shanghai) Co., Ltd.

[0068] 2. Universal Primer Amplifica...

Embodiment 2

[0099] Example 2. Using the established Mycobacterium tuberculosis nucleic acid fingerprint feature library to identify the safety of water sources

[0100] In the water source of a waterworks suspected of being the source of Helicobacter pylori infection, the pollution source samples were collected, and the samples to be tested were divided into two after moderate dilution. Among them, the sample 1 to be tested was subjected to PCR amplification and enzyme digestion according to the method of Example 1, For mass spectrometry detection, the whole process takes 1-2 hours.

[0101] The resulting mass spectrometry features image 3 Compared with the bacterial nucleic acid fingerprint feature library obtained in the third implementation, the judgment criteria adopted are:

[0102] When 2.300≤matching score≤3.000, it means that the reliability of strain identification is high;

[0103] When 2.000≤matching score<2.300, it means conservative genus identification or possible bacteri...

Embodiment 3

[0108] Embodiment 3: Biochemical analysis control experiment of sample 1 to be tested

[0109] 1. Biochemical analysis of sample 1 to be tested

[0110] 1. Prepare Helicobacter pylori isolation medium according to the following formula:

[0111] Under sterile conditions, in 150ml of prefabricated brain-heart extract agar (purchased from Difco) liquid medium, add 8ml of defibrated sheep blood, and add mixed antibiotics (vancomycin 10mg / L, trimethoprim milk salt 0.005mg / L, amphotericin B 10mg / L, polymyxin B 0.005mg / L), adjust the pH to 7.5, and then pour it into multiple petri dishes to prepare Helicobacter pylori isolation medium.

[0112] At the same time, set the control medium (i.e. antibiotics replaced by amoxicillin 10mg / L, levofloxacin 2mg / L)

[0113] 2. Experimental test

[0114] Prepare the sample 1 to be tested and the blank control (sterile water) in Example 2 to make a bacterial suspension, take 0.1ml, spread it gradually and evenly on the petri dishes of the sepa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for building a helicobacter pylori nucleic acid fingerprint spectrum, which comprises PCR (polymerase chain reaction) amplification, SAP (severe acute pancreatitis) enzymatic digestion, transcription and nuclease digestion, purification, mass spectrometer detection and the like. A helicobacter pylori nucleic acid fingerprint spectrum database is set up on the basis of the method. According to the generated mass peak spectrum of the experiment, the helicobacter pylori of a sample to be detected can be quickly identified, so the method can be widely applied in the fields of helicobacter pylori types and classification, environmental sanitation, public safety qunarantine and the like.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for establishing a nucleic acid fingerprint of Helicobacter pylori, and a method for rapidly identifying Helicobacter pylori using the method. Background technique [0002] Helicobacter pylori (Hp for short) was first discovered by Barry J. Marshall and J. Robin Warren. Helicobacter pylori belongs to the Helicobacter genus of Campylobacteraceae, which is a unipolar, multi-flagellated, blunt-ended, spirally curved bacterium. 2.5-4.0 μm long, 0.5-1.0 μm wide, Gram-staining negative, dynamic, and often presents a typical spiral or arc on the surface of gastric mucosal epithelial cells. When growing on sheep blood agar medium, except for the typical moist, colorless and transparent, flat shape and neat edges. Helicobacter pylori is a microaerophilic bacterium that requires 5-8% oxygen in the environment and cannot grow in the atmosphere or in an absolutely anaerobic environment....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12R1/01
Inventor马庆伟赵洪斌张海燕赵艳梅
OwnerBIOYONG TECH