Genome simplification and next-generation sequencing-based deoxyribose nucleic acid (DNA) library preparation method and kit
A DNA library and next-generation sequencing technology, applied in chemical libraries, biochemical equipment and methods, combinatorial chemistry, etc., can solve problems such as unclear genealogy and low quality
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Establishment of DNA library construction method based on genome simplification and next-generation sequencing.
[0055] In this example, heterozygous diploid Landrace and Large white pigs were selected as experimental materials, and the basic operation procedures based on genome simplification and next-generation sequencing DNA library construction are shown in figure 1 , including the following steps:
[0056] The first step, the extraction of genomic DNA: collect pig ear tissue samples, use tissue sample DNA extraction kit to extract genomic DNA, by figure 2 Agarose gel electrophoresis showed that the DNA had no protein and RNA contamination, and the integrity was good. The DNA sample was diluted to ~50ng / μL for use;
[0057] The second step, genomic DNA fragmentation
[0058] The high-quality genomic DNA extracted in the first step was digested (Digestion) with the methylation-sensitive restriction enzyme (Restriction enzyme) AvaII. The recognition sequence of t...
Embodiment 2
[0105] High-throughput porcine genome-wide SNP detection.
[0106] Use genome-based simplification and next-generation sequencing DNA library construction kits for research. Based on genome simplification and next-generation sequencing DNA library construction kit includes:
[0107] Primer1.1 primer and Primer2.1 primer with the following base sequences;
[0108] Primer1.1:
[0109] 5′AATGATACGGCGACCACCGAGATTCACTCTTTCCCTACACGACGCTCTTCCGATCT
[0110] Primer2.1:
[0111] 5′CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
[0112] PCR phusion mix;
[0113] Restriction endonuclease AvaII and its corresponding buffer;
[0114] T4 DNA ligase;
[0115] 72 pairs of barcode-adapter sequences, each pair of sequence structure is:
[0116] Positive strand: 5'ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXXX3',
[0117] Negative strand: 5'GWCYYYYYAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG3',
[0118] XXXXX in the positive chain represents the barcode sequence, YYYYY in the negative chai...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap