GeXP (Gene Expression) rapid detection kit capable of simultaneously identifying six virus of chicken respiratory disease
A technology of respiratory tract and kit, which is applied in the field of GeXP rapid detection kit, and achieves the effect of broad application prospect and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Embodiment 1, the design of PCR primer pair
[0034] Using the primer sequences published by GenBank as a reference, the known sequences were downloaded from NCBI and sequence alignment was performed using DNASTAR software, and highly conserved and specific gene fragments for each target gene were selected, and 7 specific primers were designed by Premier 5.0 software, and Add the GeXP universal primer (underlined sequence) at the 5' end of the primer, and the primer direction is from the 5'-3' end, as follows:
[0035] 1) Primer pair A with the M gene of avian influenza virus (AIV) as the target gene:
[0036] AIV-F1: AGGTGACACTATAGAATA AGCGATTCAAGTGATCCTCT (Sequence Listing Sequence 1);
[0037] AIV-R1: GTACGACTCACTATAGGGA AGGCACTCCTTCCGTAGAAGG (SEQ ID NO: 2);
[0038] The expected length of the amplified product (i.e. the target peak position) is 187bp;
[0039] The target sequence is Genbank DQ485227.1 771-790 and 900-920.
[0040] 2) Primer pair B targeting th...
Embodiment 2
[0070] Embodiment 2, the specific detection of PCR primer pair
[0071] 1. Template preparation
[0072] 1. Viral RNA extraction and cDNA acquisition
[0073] 1) Viral RNA extraction
[0074] Use the kit MiniBEST Viral RNA / DNA Extraction Kit Ver.4.0 (Dalian TaKaRa Company, product number DV819A) to extract RNA from the chicken embryo allantoic fluid of the following virus strains according to the kit instructions (to extract negative chicken embryo urine The sample obtained from cyst fluid is a negative control sample): Avian influenza virus strains: Duck / HK / 717 / 79-d1 (H1N3 subtype), Duck / HK / 77 / 76 (H2N3 subtype), Duck / HK / 526 / 79 / 2B (subtype H3N6), Duck / HK / 668 / 79 (subtype H4N5), Duck / HK / 531 / 79 (subtype H6N8), Turkey / ont / 6118 / 68 (subtype H8N4), Duck / Guangxi / 1 / 00 (subtype H9N2), Duck / HK / 876 / 80 (subtype H10N3), Duck / HK / 661 / 79 (subtype H11N3), Duck / HK / 862 / 80 (subtype H12N5) , Gull / MD / 704 / 77 (subtype H13N5) (document: Zhixun Xie, Yao-shan Pang, Jiabo Liu, et al.A multiplex RT-P...
Embodiment 3
[0136] Embodiment 3, the sensitivity detection of PCR primer pair
[0137] 1. Preparation of monoclonal plasmid standards containing target genes
[0138] The avian influenza virus, H5 subtype avian influenza virus, H7 subtype avian influenza virus, H9 subtype avian influenza virus, Newcastle disease virus, infectious bronchitis virus, infectious laryngotracheitis respectively obtained in step 1 in Example 2 The cDNA or DNA sample of the virus is used as a template, and the M gene of avian influenza virus obtained by PCR amplification, the HA gene of H5 subtype avian influenza virus, the HA gene of H7 subtype avian influenza virus, the HA gene of H9 subtype avian influenza virus, and the Newcastle disease The full-length cDNA or DNA fragments of viral ND gene, infectious bronchitis virus N gene and infectious laryngotracheitis virus TK gene were respectively connected with plasmid pGEM-T Easy Vector (purchased from Promega Company) to obtain seven recombinant plasmids PA , PB...
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com