Supercharge Your Innovation With Domain-Expert AI Agents!

GeXP (Gene Expression) rapid detection kit capable of simultaneously identifying six virus of chicken respiratory disease

A technology of respiratory tract and kit, which is applied in the field of GeXP rapid detection kit, and achieves the effect of broad application prospect and strong specificity

Active Publication Date: 2013-01-30
GUANGXI VETERINARY RES INST
View PDF1 Cites 23 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no reagent or kit that can simultaneously detect multiple respiratory disease viruses in poultry based on the GeXP system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GeXP (Gene Expression) rapid detection kit capable of simultaneously identifying six virus of chicken respiratory disease
  • GeXP (Gene Expression) rapid detection kit capable of simultaneously identifying six virus of chicken respiratory disease
  • GeXP (Gene Expression) rapid detection kit capable of simultaneously identifying six virus of chicken respiratory disease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1, the design of PCR primer pair

[0034] Using the primer sequences published by GenBank as a reference, the known sequences were downloaded from NCBI and sequence alignment was performed using DNASTAR software, and highly conserved and specific gene fragments for each target gene were selected, and 7 specific primers were designed by Premier 5.0 software, and Add the GeXP universal primer (underlined sequence) at the 5' end of the primer, and the primer direction is from the 5'-3' end, as follows:

[0035] 1) Primer pair A with the M gene of avian influenza virus (AIV) as the target gene:

[0036] AIV-F1: AGGTGACACTATAGAATA AGCGATTCAAGTGATCCTCT (Sequence Listing Sequence 1);

[0037] AIV-R1: GTACGACTCACTATAGGGA AGGCACTCCTTCCGTAGAAGG (SEQ ID NO: 2);

[0038] The expected length of the amplified product (i.e. the target peak position) is 187bp;

[0039] The target sequence is Genbank DQ485227.1 771-790 and 900-920.

[0040] 2) Primer pair B targeting th...

Embodiment 2

[0070] Embodiment 2, the specific detection of PCR primer pair

[0071] 1. Template preparation

[0072] 1. Viral RNA extraction and cDNA acquisition

[0073] 1) Viral RNA extraction

[0074] Use the kit MiniBEST Viral RNA / DNA Extraction Kit Ver.4.0 (Dalian TaKaRa Company, product number DV819A) to extract RNA from the chicken embryo allantoic fluid of the following virus strains according to the kit instructions (to extract negative chicken embryo urine The sample obtained from cyst fluid is a negative control sample): Avian influenza virus strains: Duck / HK / 717 / 79-d1 (H1N3 subtype), Duck / HK / 77 / 76 (H2N3 subtype), Duck / HK / 526 / 79 / 2B (subtype H3N6), Duck / HK / 668 / 79 (subtype H4N5), Duck / HK / 531 / 79 (subtype H6N8), Turkey / ont / 6118 / 68 (subtype H8N4), Duck / Guangxi / 1 / 00 (subtype H9N2), Duck / HK / 876 / 80 (subtype H10N3), Duck / HK / 661 / 79 (subtype H11N3), Duck / HK / 862 / 80 (subtype H12N5) , Gull / MD / 704 / 77 (subtype H13N5) (document: Zhixun Xie, Yao-shan Pang, Jiabo Liu, et al.A multiplex RT-P...

Embodiment 3

[0136] Embodiment 3, the sensitivity detection of PCR primer pair

[0137] 1. Preparation of monoclonal plasmid standards containing target genes

[0138] The avian influenza virus, H5 subtype avian influenza virus, H7 subtype avian influenza virus, H9 subtype avian influenza virus, Newcastle disease virus, infectious bronchitis virus, infectious laryngotracheitis respectively obtained in step 1 in Example 2 The cDNA or DNA sample of the virus is used as a template, and the M gene of avian influenza virus obtained by PCR amplification, the HA gene of H5 subtype avian influenza virus, the HA gene of H7 subtype avian influenza virus, the HA gene of H9 subtype avian influenza virus, and the Newcastle disease The full-length cDNA or DNA fragments of viral ND gene, infectious bronchitis virus N gene and infectious laryngotracheitis virus TK gene were respectively connected with plasmid pGEM-T Easy Vector (purchased from Promega Company) to obtain seven recombinant plasmids PA , PB...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a GeXP (Gene Expression) rapid detection kit capable of simultaneously identifying six virus of chicken respiratory disease. The GeXP rapid detection kit is used basing on a CeXP system and contains seven PCR (Polymerase Chain Reaction) primer pairs, the specificity for simultaneously detecting avian influence virus, H5, H7 and H9 sub type of the avian influence virus, Newcastle disease virus, infectious bronchitis virus and infectious laryngotracheitis virus is strong, the sensitivity can be up to 100 copy / mu l, and compared with an identifying result of regular test methods such as virus isolation and hemagglutination inhibition, the coincidence rate is up to 100%. According to the GeXP rapid detection kit disclosed by the invention, a simple and high-throughput detection kit and a detection system are provided for the detection of common main chicken viral respiratory disease, the actual needs are accordant, and the application prospect is wide.

Description

technical field [0001] The invention relates to a GeXP rapid detection kit for simultaneously identifying six kinds of chicken respiratory disease viruses. Background technique [0002] H5, H7 and H9 subtype avian influenza, Newcastle disease, infectious bronchitis and infectious laryngotracheitis are six major viral respiratory infectious diseases that seriously harm chickens. These infectious diseases can infect chickens of different ages, have high morbidity and mortality, and their clinical symptoms are very similar. The traditional conventional methods for differential diagnosis of these respiratory diseases mainly include pathogen isolation and identification and serological tests, etc., but these methods are often limited by the freshness of clinical materials, pollution degree or course of disease, and the operation is very cumbersome and time-consuming. Differential diagnosis is more difficult. In recent years, with the development of molecular biology, PCR techno...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
Inventor 谢芝勋罗思思谢丽基邓显文谢志勤庞耀珊刘加波范晴
Owner GUANGXI VETERINARY RES INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More