Unlock instant, AI-driven research and patent intelligence for your innovation.

Construction method for linearized expression vector and simulated vector segments used for construction of linearized expression vector

A technology of expression vector and construction method, which can be applied in the direction of using vector to introduce foreign genetic material, recombinant DNA technology, etc., and can solve problems such as failure to be further popularized and applied.

Inactive Publication Date: 2013-02-06
尚玉栓
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In practical application, these methods are subject to certain limitations and cannot be further promoted and applied.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method for linearized expression vector and simulated vector segments used for construction of linearized expression vector
  • Construction method for linearized expression vector and simulated vector segments used for construction of linearized expression vector
  • Construction method for linearized expression vector and simulated vector segments used for construction of linearized expression vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] Preparing pre and post class vector fragments

[0080] In order to facilitate the preparation of front and back vector fragments, in the embodiment of the present invention, it is first constructed on a plasmid vector, and the spare front and back vector fragments can be obtained through the steps of plasmid purification, enzyme digestion and recovery.

[0081] The sequence SEQ ID NO: 1 containing the former vector fragment was constructed in plasmid pUC18 as follows: 1) with primers (5' ATGCGGATCCTACGTAAACATCCAAAGACGAAAGG 3' (SEQ ID NO: 3), 5' ATGCCTGCAGGTAGACTCGATCCTTCGAATAATTAG 3' (SEQ ID NO: 4)) Amplify the sequence of about 7bp-944bp of the plasmid pPIC9K, recover the amplified product from the gel and double-digest it with restriction endonucleases BamH I and Pst I, and recover the digested product from the gel for later use; Endonucleases BamH I and Pst I were double-digested and gel-recovered for later use; 3) Ligated the enzyme-digested vector and the fragment ...

Embodiment 2

[0091] Preparation of target gene fragments

[0092] Design two primers to amplify the green fluorescent protein GFP gene, and add the base CTA to the 5' end of the upstream primer (note: because the first amino acid is coded by ATG, in order to ensure the correct reading frame, the first base of the GFP gene A is replaced by A in the CTA base), the base GTCA and stop codon are added to the 5' end of the downstream primer, and the sequence of the primer is as follows:

[0093] Upstream primer 5' CTAs TGGTGAGCAAGG 3' (SEQ ID NO: 9)

[0094] downstream primer 5' GTCA TTATACTTGTACAGC 3' (SEQ ID NO: 10)

[0095] The conditions for PCR amplification were: 10×Pyrobest DNA Polymorase Buffer, 5 μL; dNTP (10 mM), 4 μL; upstream primer (20 μM), 1 μL; downstream primer (20 μM), 1 μL; plasmid pEGFP-C1 (GenBank Accession #: U55763), 1ng; Pyrobest DNA Polymerase (TaKaRa Code DR005A), 0.5-1U; add distilled water to a total volume of 50μL. The PCR cycle conditions are: 94°C for 5 min; ...

Embodiment 3

[0100] The above-prepared carrier-like fragments and target gene fragments were connected with E. coli ligase (E.coli DNA Ligase, TaKaRa Code D2160A), and the reaction system was: carrier-like fragments, 10 pmol each; target gene fragments, 10 pmol; 10×E. coli DNA Ligase Buffer, 10 μL; 10×BSA (0.05%) 10 μL; E.coli DNA Ligase, 3U; add distilled water to a total volume of 100 μL, react at 16°C for 3 hours, and monitor the reaction by 0.8-1% agarose gel electrophoresis (result Such as Figure 5 : Swimming lane 3 is the test result of ligation for 3 hours, and swimming lane 2 is the control group without ligase), and the DNA fragment of 7.3kb was collected by gel for use. This fragment is the linearized plasmid of "pre-type vector-GFP-back-type vector" vector fragment. From the electrophoresis results, it can be seen that the connection efficiency is very efficient and accurate, and there are basically few wrongly connected bands. Density scanning of the 5.65kb fragment found tha...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a construction method for a linearized expression vector and simulated vector segments used for the construction of the linearized expression vector. The construction method for the linearized expression vector comprises the following steps of designing and constructing a front simulated vector segment, a back simulated vector segment and a target gene segment; and connecting the front simulated vector segment, the back simulated vector segment and the target gene segment with ligase to obtain a linearized double-strand DNA expression vector. The invention further provides the simulated vector segments used for the construction of the linearized expression vector. By preparing simulated linearized vector segments through efficient and accurate connection reaction, a process of obtaining the linearized vector segments through the construction of complex and time-consuming ring-shaped plasmid vectors can be avoided; and simultaneously, and the generation of target gene terminals is not limited by the sequence, so that operations are greatly simplified; cost can be reduced; experimental period is shortened; and the method has very good application prospects in expression systems of yeast and the like.

Description

technical field [0001] The invention relates to a biological gene recombination expression technology, in particular to a method for constructing a linearized expression vector by directly constructing a linearized carrier fragment through an efficient and accurate ligation reaction and a carrier-like fragment used for the construction of a linearized expression vector. Background technique [0002] Gene recombination expression technology has been widely used in today's biological science research and industrialization. At present, there are many kinds of host organisms for gene recombinant expression, such as Escherichia coli, Bacillus subtilis, yeast and mammalian cells. In many cases, when using these host organisms to express the target gene, it is necessary to construct a circular plasmid vector correctly inserted into the target gene in Escherichia coli, and then transform the host organism after purification and linearization of the vector. It is integrated into the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/66C12N15/63
Inventor 尚玉栓
Owner 尚玉栓