New Delhi metallo-beta-lactamase-1 aptamer, its screening method and application
A technology of β-lactamase and nucleic acid aptamer, which is applied in biochemical equipment and methods, DNA preparation, DNA/RNA fragments, etc., can solve the problems of time-consuming, disease delay, etc., and achieve stable physical and chemical properties, simple production process, The effect of shortening the detection time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Embodiment 1: nucleic acid aptamer
[0042] The nucleotide sequence of the nucleic acid aptamer is:
[0043] GCAATGGTACGGTACTTCCTGTTTTATGTTGTGTGTCTTGTTTTGCTACTTTTCGCCGGCCGTTCAAAAGTGCACGCTACTTTGCTAA (SEQ ID NO: 1).
Embodiment 2
[0044] Example 2 Nucleic acid aptamer screening method
[0045] 1. Main reagents and buffers:
[0046] (1) Main reagents:
[0047] 1. NDM-1 for nucleic acid aptamer screening
[0048]The NDM-1 selected in the present invention has a purity greater than 99%, and was kindly donated by Professor Jean-Denis Docquier of the University of Siena, Italy.
[0049] The SDS-PAGE silver staining results of NDM-1 are shown in Figure 1.
[0050] In Figure 1: the first lane is protein MARKER, the second to fourth lanes are the results of NDM-1 electrophoresis, the second lane is 10ng, the third lane is 20ng, and the fourth lane is 40ng protein; the arrow points to NDM-1 protein electrophoresis Bands.
[0051] The results of electrophoresis showed that no obvious protein jumping was seen in the protein electrophoresis band, indicating that the enzyme had a high purity and could be used for the screening of nucleic acid aptamers.
[0052] 2. Random single-stranded DNA library
[00...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com