Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant porcine interferon beta1, encoding gene and expression method thereof

A porcine interferon and gene technology, applied in chemical instruments and methods, botany equipment and methods, and microbial-based methods, can solve problems affecting yield, affecting product quality, and reducing the specific activity rate of recombinant proteins, etc.

Active Publication Date: 2013-04-24
GENSUN INST OF BIOMEDICINE
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If the renaturation conditions are not suitable, it will lead to the mismatch of intramolecular disulfide bonds, and the formation of aggregates through covalent or hydrophobic bonding between molecules, so that the product will be precipitated, affecting the yield, and reducing the specific activity of the recombinant protein. rate, affecting product quality

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant porcine interferon beta1, encoding gene and expression method thereof
  • Recombinant porcine interferon beta1, encoding gene and expression method thereof
  • Recombinant porcine interferon beta1, encoding gene and expression method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1 Recombinant porcine interferon beta 1 gene optimization design

[0060] 1. Codon optimization

[0061] There are 64 genetic codes, but most organisms tend to use a subset of these. Those that are most frequently used are called optimal codons, and those that are not frequently used are called rare or low-usage codons. Virtually every organism commonly used for protein expression or production (including E. coli, yeast, mammalian cells, plant cells, and insect cells) exhibits some degree of difference or bias in codon usage. The expression efficiency of genes containing optimal codons in E. coli, yeast and Drosophila was significantly higher than that of genes containing low utilization codons. Therefore, in the heterologous expression system, the codon bias largely affects the expression of recombinant proteins. Gene synthesis using preferred codons and avoiding rare codons is called codon optimization. The optimization process fully takes into account v...

Embodiment 2

[0085] Embodiment 2: the expression plasmid construction of recombinant porcine interferon beta 1 gene

[0086] The fragment synthesized from the optimized recombinant porcine interferon β1 gene (as shown in SEQ ID No: 1) was constructed into the pUC57 plasmid (provided by Nanjing KingScript Technology Co., Ltd.) to obtain a long-term preservation plasmid, which was recorded as It is the pUC57-prIFNβ1 plasmid. Using the pUC57-prIFNβ1 plasmid as a template, the upstream and downstream primers were respectively introduced into NdeI and XhoI restriction sites for PCR amplification. The sequences of the primers used are as follows:

[0087] Upstream primers:

[0088] P1: CGGGAATTCCATATGATGTCCTATGATGTTCTGCG

[0089] Downstream primers:

[0090] P2: CCGCTCGAGTTAATTGCGCAGATAATCCGTC

[0091] The total volume of the reaction was 50 μL, in which 2.5 μL of each primer was added at a concentration of 10 μmol / L, and 1 μL of dNTP at a concentration of 10 mmol / L was added. The DNA poly...

Embodiment 3

[0093] Example 3 Expression and Identification of Recombinant Porcine Interferon β1 in Escherichia coli

[0094] Specific steps are as follows:

[0095] 1. The pET21b-prIFNβ1 plasmid with correct sequencing alignment in Example 2 was transformed into a competent strain of Escherichia coli BL21 (DE3) (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.), and cultured overnight on an ampicillin plate at 37°C.

[0096] 2. On the second day, pick 1-4 recombinant colonies containing the pET21b-prIFNβ1 plasmid, insert them into LB medium containing 100 μg / mL ampicillin, and culture them overnight at 37°C.

[0097] 3. Take 50 μL of the overnight culture and insert it into 5 mL of LB induction medium containing 100 μg / mL ampicillin, and culture at 37°C with shaking.

[0098] 4. The OD600 value of the bacterial solution was measured every 1 h after inoculation, and when the OD600=1.0, the expression was induced with 1 mmol / L IPTG (purchased from Amresco). At the sam...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides recombinant porcine interferon beta1, an encoding gene and an expression, purification and inclusion body refolding method and belongs to the field of biological genetic engineering. The recombinant porcine interferon beta1 has wide medical prospect in the field of veterinary medicine as a nonspecific broad-spectrum anti-viral biological preparation, but has the problems of shortage of throughput, high price, different drug specifications, and the like just as most genetic engineering drugs. In order to obtain a lot of recombinant porcine interferon beta1, an escherichia coli expression system is adopted to carry out heterologous expression on the recombinant porcine interferon beta1 gene optimized by a codon. In addition, an inclusion body purifying and refolding method of the recombinant porcine interferon beta1 is also provided by the invention aiming at the problem that the porcine interferon beta1 in a prokaryotic expression system is mostly expressed in a form of an inclusion body, so that the prepared porcine interferon beta1 has high activity and reaches the standard of industrial production.

Description

technical field [0001] The invention belongs to the field of bioengineering genes, and relates to a recombinant porcine interferon beta 1 and its encoding gene, as well as its expression, purification and inclusion body renaturation methods. Background technique [0002] Interferon (Interferon, IFN) is a group of active proteins (mainly glycoproteins) with multiple functions, and is a cytokine produced by monocytes and lymphocytes. They have broad-spectrum anti-virus, affect cell growth, differentiation, regulation of immune function and other biological activities on the same kind of cells. According to the source of IFN, that is, animal species, cell type, the nature of the inducer and the induction conditions, it can be divided into three types: α, β, and γ. Among them, interferon β is mainly produced by fibroblasts, which can enhance the expression of HLA1 and class II antigens on the cell surface in vivo, and increase serum levels of new butterfly and β. 2 - Microglob...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/565C12N15/22C12N15/63C12N1/21C12P21/02C07K1/14A61K38/21A61P31/14A61P31/16A61P37/04C12R1/19
Inventor 马永王安良章成昌徐春林陈晨王耀方
Owner GENSUN INST OF BIOMEDICINE