Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Promoter and applications thereof

A technology of promoters and eukaryotic expression vectors, applied in the field of promoters and their applications, and plant promoters, can solve problems such as lagging, restriction function analysis and application exploration research, and weak research on tobacco damage-induced expression gene promoters

Inactive Publication Date: 2013-07-17
TOBACCO RES INST CHIN AGRI SCI ACAD
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, so far, the research on the promoters of tobacco damage-induced expression genes is still weak and lagging behind, which also restricts its functional analysis and application exploration research to a certain extent.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Promoter and applications thereof
  • Promoter and applications thereof
  • Promoter and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1: Isolation of Tobacco Lipoxygenase Gene NtLOX3 Promoter

[0018] 1.1. Preparation of tobacco genomic DNA

[0019] The young leaves of the tobacco planted in the greenhouse for two months were taken, and the genomic DNA was extracted by the CTAB method, which was detected by agarose gel electrophoresis and stored at -20°C.

[0020] 1.2 Cloning and sequence analysis of NtLOX3 promoter

[0021] Using tobacco genomic DNA as a template, the upstream primer is: GGGGTACCGCCAGGTCTAAGGAAGG (SEQ ID NO: 2), the downstream primer is: GAAGATCTAATAATAATAGTTTCTCTCTTCAATT (SEQ ID NO: 3), the NtLOX3 promoter candidate region is obtained by PCR amplification, and the PCR reaction conditions are: 94 Pre-denaturation at ℃ for 4min, denaturation at 94℃ for 4min, annealing at 49.3℃ for 45s, extension at 72℃ for 2min, a total of 28 cycles, and storage at 4℃. The PCR product was connected to the pEASY-T1 vector, cloned and subjected to plasmid PCR detection (the plasmid was named p...

Embodiment 2

[0022] Embodiment 2: Construction of plant damage-inducible expression vector

[0023] The pCAMBIA1301 vector was digested with Kpn I / BglII, and the large fragment was recovered for use. After the pEASY-T1::NtLOX3-Promoter plasmid in Example 1 was digested with Kpn I / BglII, the target promoter fragment with a length of 1847 bp was recovered. In a 10μl system, connect the target fragment and the carrier fragment with T4 DNA ligase, and identify by PCR ( figure 2 ) and enzyme digestion identification ( image 3 ) to identify positive recombinants. Thereby the promoter of the present invention replaces the CaMV35S promoter on the vector pCAMBIA1301, and is fused with the Gus gene to obtain the plant recombinant expression vector pCAMBIA1301::NtLOX3-Promoter ( Figure 4 ).

Embodiment 3

[0024] Example 3: Identification of Tobacco Lesion Inducible Promoter Activity

[0025] 3.1 Agrobacterium-mediated plant transformation

[0026]By electric shock transformation, the plant recombinant expression vector pCAMBIA1301::NtLOX3-Promoter constructed in Example 2 expressing the Gus gene was transformed into EHA105 in Agrobacterium, and the plasmid was extracted and identified by PCR ( Figure 5 ), to confirm that the plasmid was actually transferred into Agrobacterium.

[0027] Take the tobacco seeds, sterilize them with alcohol and sodium hypochlorite, and sow them on the seedling growth medium, and wait for the seedlings to grow to about 0.5 cm and transfer them to the transplanting seedling medium. When the leaves grow to 5-8 leaves, select the green leaves and carry out the above-mentioned Agrobacterium infection transformed into pCAMBIA1301::NtLOX3-Promoter. Specifically, add 20mg of Agrobacterium cultured at 28°C with OD600=0.8 / L of AS (acetosyringone), transf...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a damage-induced type promoter, and the nucleotide sequence of the promoter is SEQ ID NO: 1. The promoter can be used for constructing a eukaryotic expression vector which is used for expressing a foreign gene in a plant. The separation and identification of the high-efficiency tobacco induction type starter can provide experiment and technology support for the research and development of a tobacco bioreactor. By taking tobacco as the bioreactor, the high-efficiency induction type starter is utilized for expressing vaccine, antibody, other pharmaceutical protein and the like, thereby being capable of breaking through the traditional agricultural category and extending to the medical field.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and specifically relates to a promoter and application thereof, that is, a plant promoter capable of initiating the expression of regulatory genes under damage stress. Background technique [0002] In the research of genetic engineering, it has become the current trend to express the exogenous target gene in the recipient organism to improve the resistance of crops to environmental stresses such as drought, salt, alkali, pests and diseases, or to improve crop quality and crop agronomic traits. An important means of crop variety improvement. In recent years, the isolation and research on promoters has become one of the hotspots at home and abroad. The development of genetic engineering has made great contributions to the study of crop resistance to pests and diseases and the study of plant bioreactors. However, how to control the timing and quantitative high-efficiency expression of exogenous ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/82C12N15/84
Inventor 解敏敏王根洪夏庆友孙玉合龚达平
Owner TOBACCO RES INST CHIN AGRI SCI ACAD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com