Construct and application thereof
A technology of constructs and receptors, applied in the field of bioengineering, can solve problems such as limited genetic resources and needs to be improved, and achieve the effect of improving efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] Example 1 Construct Preparation
[0062] 1. Synthesis of cyanobacteria ictB gene and construction of vector pUC57-ictB
[0063] The inventor commissioned Sangon Bioengineering Co., Ltd. to synthesize the cyanobacteria ictB gene (SEQ ID NO: 1), and added restriction enzyme sites BamHI and XbaI to the upstream and downstream of the synthetic gene, in order to obtain the following: Shown in SEQ ID NO: 2 Nucleic acid sequence, and connected to the vector pUC57, so as to obtain the pUC57-ictB vector.
[0064] GGATCC ACCATGGCTGAGGCTTCAGAACCGTCTCCATGGTTGCTGCGCTGGCAAG GATGTCTCCCCAGCTCGGCAGCCCAACAAAAGCGCCTCGCCAATCTGGCCGGCATTGT TTTGATCCTCCTGCTTGCAGGACTGCCCCTGGTGACGCGCACGGGGCTGGGACTGATC GTGCTGGCGTGTGGTGCGCTCTGGCTGCTGTGGTCGCTCAGCAAGCCTCCCGAGCGGC TGGGTGAAATCAGCGGTTGGCTGCTGCTGTTCCTGGCTGTCGCCGTGCTGGCCACAGG CTTCTCGCCAGTTCCCGCCGCGGCCCTCAAGGGGCTGGTGAAGCTGCTCAGCTATCTG GGGGTTTATGCACTGATGCGCCAGCTTCTCGCCGTTCGCCCTGCATGGTGGGACCGGCT GCTGGCGGCTCTGCTCGGGGGATCGTTGCTGACCGATGTGCTCGCCCTGCGCCAGCTCT...
Embodiment 2
[0104] Example 2 Preparation of recombinant Agrobacterium tumefaciens EHA105-p6+ictB cells
[0105] According to the calcium chloride method described in "Molecular Cloning Experiment Guide" (third edition, Science Press), the p6+ictB recombinant construct plasmid prepared in Example 1 was transformed into Agrobacterium tumefaciens EHA105 (December 24, 2009 Competent cells preserved in the Wuhan University Collection Center, Luojia Mountain, Wuchang, Wuhan City, Hubei Province, namely the China Center for Type Culture Collection (CCTCC), the preservation number is CCTCC M209315). The specific methods are as follows:
[0106]The Agrobacterium tumefaciens competent cells EHA105 were taken out from the ultra-low temperature refrigerator and thawed on ice. After thawing, add 5 μl of p6+ictB recombinant vector, mix gently, place in ice bath for 10 minutes, freeze in liquid nitrogen for 5 minutes, thaw at 37°C for 5 minutes, add 800 μl of normal temperature LB liquid medium, recover...
Embodiment 3
[0110] Induction and Transformation of Embodiment 3 Rice Callus
[0111] The rice callus was induced according to the following steps, and the recombinant Agrobacterium tumefaciens EHA105-p6+ictB prepared in Example 2 was used to transform the callus:
[0112] (1) Rice Nipponbare seeds (preserved at the Wuhan University Collection Center, Luojia Mountain, Wuchang, Wuhan City, Hubei Province on December 18, 2009, that is, the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC P200910) were shelled, 70 Disinfect the surface with % ethanol for 30s, then disinfect with sodium hypochlorite with 1.5% available chlorine for 30min, shake vigorously during the period, wash with sterilized water for 5 times after disinfection; put the sterilized seeds on N6D medium and seal with parafilm; 28℃ Dark culture for 6-8 weeks;
[0113] (2) Select actively growing callus tissue (yellow-white, dry, 1-3mm in diameter) and culture it in the dark at 28°C on new ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com