Multi-gene detection method of Listeria monocytogenes based on quantum dot/graphene oxide nanometer platform

A technology for the detection of Listeria monocytogenes and a detection method, which is applied in the field of detection of multiple genes of Listeria monocytogenes, can solve the problems of low signal-to-noise ratio, cumbersome steps, false negatives, etc., and achieve the effect of high sensitivity and simple detection process

Inactive Publication Date: 2014-11-26
SOUTH CHINA NORMAL UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These technologies have completely changed the original foodborne pathogen detection technology system, but the above methods have their own shortcomings, such as low signal-to-noise ratio, background signal interference, use of toxic and harmful reagents, cumbersome steps, etc., and Most of these technologies are based on single-gene detection technologies. For highly infectious, highly pathogenic and widespread food-borne pathogens, detection technologies that only focus on single genes cannot obtain sufficient reliability and are prone to false positives. Negative and missed tests and other issues

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multi-gene detection method of Listeria monocytogenes based on quantum dot/graphene oxide nanometer platform
  • Multi-gene detection method of Listeria monocytogenes based on quantum dot/graphene oxide nanometer platform
  • Multi-gene detection method of Listeria monocytogenes based on quantum dot/graphene oxide nanometer platform

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0035] The multigene detection method of Listeria monocytogenes based on the quantum dot / graphene oxide nano-platform of the present invention comprises the following steps:

[0036] 1) Primer design

[0037] Use DNAman to analyze the conserved region of the target gene to determine the conserved region of the target gene. The primer design software Primer Premier was used to design primers for hlyA and iap genes respectively. The designed sequences were purchased from Shanghai Yingjun, and the purification method was iDSL. The primer sequences are shown in the table below:

[0038] Table 1. hlyA and iap gene LATE-PCR primer sequences

[0039] Primer name

Primer sequence

theoretical annealing temperature

hly A restriction primer

GCTGCCGTAAGTGGGAAATCTGTCTCAG

70.4°C

hly A excess primer

ATGATTTGAACTTCATCTTTTGC

59.9°C

iap1 restriction primer

AACAAGCTGCACCTGCTGCAGA

70.3°C

iap2 excess primer

CTTTTGACAGCGTGTGT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a multi-gene detection method of Listeria monocytogenes based on a quantum dot / graphene oxide nanometer platform and belongs to the technical field of gene nanometer detection. The multi-gene detection method of Listeria monocytogenes comprises the following steps of: selecting two or more than two genes of the Listeria monocytogenes as target points of genetic detection and designing two pairs or more than two pairs of genetic PCR (Polymerase Chain Reaction) amplimers according to the analysis result of a gene conserved area; amplifying two or more than two genetic special sequences at the same time according to the principle of LATE-PCR to obtain a corresponding single stranded amplification product; then, hybridizing the single stranded amplification product with a quantum dot fluorescence probe; and finally, quenching and removing the non-hybridized quantum dot probe by using graphene oxide. When the target gene does not exist, all quantum dot fluorescence probes are quenched. On the contrary, when the target gene exists, corresponding fluorescent signals are obtained. The detection method has high detection reliability to Listeria monocytogenes.

Description

technical field [0001] The invention belongs to the technical field of gene nanometer detection, in particular to a method for detecting multiple genes of Listeria monocytogenes based on a quantum dot / graphene oxide nanometer platform. Background technique [0002] Foodborne pathogens are one of the important reasons affecting food safety, seriously threatening human health, and bringing huge economic losses to human society. According to the U.S. Centers for Disease Control and Prevention, there are 7,600 cases of food-borne pathogens in the U.S. each year, including 5,000 deaths. Therefore, a complete food pathogen detection method system has become an important measure for the supervision of food safety in countries all over the world. Foodborne pathogenic bacteria come from various sources, can multiply rapidly in food, and can survive in harsh environments, which brings great challenges to the detection, prevention and treatment of foodborne pathogenic bacteria, and po...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68C12Q1/04G01N21/64
Inventor周小明邢达廖玉辉
OwnerSOUTH CHINA NORMAL UNIVERSITY