A nucleic acid detection kit and a multi-biotin signal amplification method for nucleic acid detection
A technology for detecting kits and nucleic acids, which is applied to biochemical equipment and methods, and microbial measurement/inspection. It can solve the problems of insufficient magnification and insufficient probe sensitivity, achieve high sensitivity, simplify operation steps, and avoid pollution. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Embodiment 1, HPV detects
[0036] 1. Design and synthesis of capture molecules, capture bridge molecules, amplification bridge molecules, marker molecules and carrier molecules:
[0037] Capture molecule: GTTGGGCTACGACTTAGAGGCC (SEQ ID No 1)
[0038] Marker molecule 1: Biotin-ACCCGATGGATAGGTCGGTGAA (SEQ ID No 2)
[0039] Marker molecule 2: Biotin-TAAGCATCGTGCCCTTTCGCAG (SEQ ID No 3)
[0040] Marker molecule 3: biotin-ACCACGTTCGCGTTCTCACATG (SEQ ID No 4)
[0041] Carrier molecule:
[0042] AGAAGGCGTCCGTCTTTGAGGCTTCACCGACCTATCCATCGGGTCTGCGAAAGGGCACGATGCTTACATGTGAGAACGCGAACGTGGT (SEQ ID No. 5)
[0043] According to the sequence of HPV in the genebank, the sequences of the capture bridge molecule and the amplification bridge molecule are designed, and the sequences are as follows:
[0044] Capture bridge molecule: CAGGTAGCTTGTAGGGttttGGCCTCTAAGTCGTAGCCCAAC (SEQ ID No 6)
[0045] Amplifying bridge molecule 1: AATAAATCTTTAAATGttttAGAAGGCGTCCGTCTTTGAGGC (SEQ ID No 7)
...
Embodiment 2
[0061] Example 2: Detection of Chemotherapy Drug Sensitivity in Advanced or Metastatic Non-small Cell Lung Cancer
[0062] A large number of clinical studies have confirmed that the expression level of genes related to the action or metabolism of chemotherapy drugs in tumor cells has an important impact on the efficacy of chemotherapy. The mRNA expression levels of target genes such as ERCC1 / RRM1 / TYMS / TUBB3 in tumor tissue can respectively predict the response of patients to commonly used chemotherapy drugs such as platinum / gemcitabine / fluorine / anti-microtubule. Studies have reported that high levels of ERCC1 expression are unfavorable to platinum-based adjuvant chemotherapy; ERCC1-negative patients show a good benefit rate for platinum-based adjuvant chemotherapy. The level of ERCC1 can be regarded as one of the key genes of platinum drug resistance, and the corresponding relationship has been found in lung cancer, breast cancer, ovarian cancer, bladder cancer, liver cancer, ...
Embodiment 3
[0129] Example 3. MP detection
[0130] 1. Design and synthesis of capture molecules, capture bridge molecules, amplification bridge molecules, marker molecules and carrier molecules:
[0131] Capture molecule: GTTGGGCTACGACTTAGAGGCC (SEQ ID No 20)
[0132] Marker molecule 1: Biotin-ACCCGATGGATAGGTCGGTGAA (SEQ ID No 21)
[0133] Marker molecule 2: Biotin-TAAGCATCGTGCCCTTTCGCAG (SEQ ID No 22)
[0134] Marker molecule 3: biotin-ACCACGTTCGCGTTCTCACATG (SEQ ID No 23)
[0135] Carrier molecule:
[0136] AGAAGGCGTCCGTCTTTGAGGCTTCACCGACCTATCCATCGGGTCTGCGAAAGGGCACGATGCTTACATGTGAGAACGCGAACGTGGT (SEQ ID No 24)
[0137] According to the 16srRNA sequence of MP in the genebank, the sequences of the capture bridge molecule and the amplification bridge molecule were designed as follows:
[0138] Capture bridge molecule: cgacacgagctgacgttttGGCCTCTAAGTCGTAGCCCAAC (SEQ ID No 25)
[0139] Amplified bridge molecule 1: tgcgctcgttgcgggattttAGAAGGCGTCCGTCTTTGAGGC (SEQ ID No 26)
[0140] Ampli...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

