Unlock instant, AI-driven research and patent intelligence for your innovation.

A nucleic acid detection kit and a multi-biotin signal amplification method for nucleic acid detection

A technology for detecting kits and nucleic acids, which is applied to biochemical equipment and methods, and microbial measurement/inspection. It can solve the problems of insufficient magnification and insufficient probe sensitivity, achieve high sensitivity, simplify operation steps, and avoid pollution. Effect

Active Publication Date: 2017-04-12
武汉中帜生物科技股份有限公司 +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, its magnification is not enough, the sensitivity of the probe is not high enough, and it cannot meet the needs of practical applications in some fields.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A nucleic acid detection kit and a multi-biotin signal amplification method for nucleic acid detection
  • A nucleic acid detection kit and a multi-biotin signal amplification method for nucleic acid detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1, HPV detects

[0036] 1. Design and synthesis of capture molecules, capture bridge molecules, amplification bridge molecules, marker molecules and carrier molecules:

[0037] Capture molecule: GTTGGGCTACGACTTAGAGGCC (SEQ ID No 1)

[0038] Marker molecule 1: Biotin-ACCCGATGGATAGGTCGGTGAA (SEQ ID No 2)

[0039] Marker molecule 2: Biotin-TAAGCATCGTGCCCTTTCGCAG (SEQ ID No 3)

[0040] Marker molecule 3: biotin-ACCACGTTCGCGTTCTCACATG (SEQ ID No 4)

[0041] Carrier molecule:

[0042] AGAAGGCGTCCGTCTTTGAGGCTTCACCGACCTATCCATCGGGTCTGCGAAAGGGCACGATGCTTACATGTGAGAACGCGAACGTGGT (SEQ ID No. 5)

[0043] According to the sequence of HPV in the genebank, the sequences of the capture bridge molecule and the amplification bridge molecule are designed, and the sequences are as follows:

[0044] Capture bridge molecule: CAGGTAGCTTGTAGGGttttGGCCTCTAAGTCGTAGCCCAAC (SEQ ID No 6)

[0045] Amplifying bridge molecule 1: AATAAATCTTTAAATGttttAGAAGGCGTCCGTCTTTGAGGC (SEQ ID No 7)

...

Embodiment 2

[0061] Example 2: Detection of Chemotherapy Drug Sensitivity in Advanced or Metastatic Non-small Cell Lung Cancer

[0062] A large number of clinical studies have confirmed that the expression level of genes related to the action or metabolism of chemotherapy drugs in tumor cells has an important impact on the efficacy of chemotherapy. The mRNA expression levels of target genes such as ERCC1 / RRM1 / TYMS / TUBB3 in tumor tissue can respectively predict the response of patients to commonly used chemotherapy drugs such as platinum / gemcitabine / fluorine / anti-microtubule. Studies have reported that high levels of ERCC1 expression are unfavorable to platinum-based adjuvant chemotherapy; ERCC1-negative patients show a good benefit rate for platinum-based adjuvant chemotherapy. The level of ERCC1 can be regarded as one of the key genes of platinum drug resistance, and the corresponding relationship has been found in lung cancer, breast cancer, ovarian cancer, bladder cancer, liver cancer, ...

Embodiment 3

[0129] Example 3. MP detection

[0130] 1. Design and synthesis of capture molecules, capture bridge molecules, amplification bridge molecules, marker molecules and carrier molecules:

[0131] Capture molecule: GTTGGGCTACGACTTAGAGGCC (SEQ ID No 20)

[0132] Marker molecule 1: Biotin-ACCCGATGGATAGGTCGGTGAA (SEQ ID No 21)

[0133] Marker molecule 2: Biotin-TAAGCATCGTGCCCTTTCGCAG (SEQ ID No 22)

[0134] Marker molecule 3: biotin-ACCACGTTCGCGTTCTCACATG (SEQ ID No 23)

[0135] Carrier molecule:

[0136] AGAAGGCGTCCGTCTTTGAGGCTTCACCGACCTATCCATCGGGTCTGCGAAAGGGCACGATGCTTACATGTGAGAACGCGAACGTGGT (SEQ ID No 24)

[0137] According to the 16srRNA sequence of MP in the genebank, the sequences of the capture bridge molecule and the amplification bridge molecule were designed as follows:

[0138] Capture bridge molecule: cgacacgagctgacgttttGGCCTCTAAGTCGTAGCCCAAC (SEQ ID No 25)

[0139] Amplified bridge molecule 1: tgcgctcgttgcgggattttAGAAGGCGTCCGTCTTTGAGGC (SEQ ID No 26)

[0140] Ampli...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a nucleic acid detection kit and a method for detecting nucleic acid by amplifying plurality of biotin signals. The kit comprises a capturing molecule and a capturing bridge molecule, wherein the capturing molecule is oligonucleotide and is covered on a solid phase; one end of the capturing bridge molecule can be partially hybridized with the capturing molecule and the other end of the capturing bridge molecule can be partially hybridized with a nucleic acid target molecule to be detected; the kit further comprises an amplification bridge molecule and an amplification molecule; and the amplification molecule comprises a carrier molecule and a mark molecule. The mark molecule is polynucleotide marked by a biotin; one carrier molecule is connected with a plurality of biotin molecules through the polynucleotide; and one end of the amplification bridge molecule can be partially hybridized with the nucleic acid target molecule to be detected and the other end of the amplification bridge molecule can be partially hybridized with the carrier molecule. According to the kit disclosed by the invention, signals are subjected to secondary amplification through the amplification molecule, so that the detection method disclosed by the invention has the very high sensitivity, the inherent pollution problem of PCR (Polymerase Chain Reaction) is avoided, and operation steps are greatly simplified.

Description

technical field [0001] The invention relates to a nucleic acid detection kit and a nucleic acid detection method, belonging to the field of biological detection. Background technique [0002] There are two main approaches for nucleic acid detection: (1) template amplification technology, which increases sensitivity by amplifying target sequences, (2) signal amplification system, which increases sensitivity by amplifying signal strength, which responds quickly and is simple and easy OK, no interference from template amplification. [0003] The rapid development of nucleic acid signal amplification detection methods in recent years has effectively improved the sensitivity and specificity of nucleic acid detection. Commonly used signal amplification systems include branched DNA probes, 3DNA dendrimers, etc. In the bDNA approach, signal amplification is achieved by hybridization of alkaline phosphatase (AP)-labeled oligonucleotides to a dendritic nucleic acid branch. A synthe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 李先强姜昕
Owner 武汉中帜生物科技股份有限公司