Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Nucleic acid construct for expressing oxidative stress indicator and use thereof

A nucleic acid construct, oxidative stress technology, applied in material analysis by observing the effect on chemical indicators, compound screening/testing, and analysis by chemically reacting materials, etc. The device and reporter protein are not suitable for individual observation, and the sensitivity is insufficient, so as to achieve the effect of improving the S/N ratio.

Active Publication Date: 2013-09-11
RIKEN
View PDF10 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these methods are difficult to identify organs subjected to oxidative stress on an individual level due to the process of lysing cells.
So far, a reporter that expresses alkaline phosphatase from an oxidative stress-dependent promoter induced by Nrf2 has been produced, but the sensitivity is insufficient, and the reporter protein is not suitable for individual observation, so individual animal analysis cannot be performed, and Analysis only at the level of cultured cells (Non-Patent Document 16)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid construct for expressing oxidative stress indicator and use thereof
  • Nucleic acid construct for expressing oxidative stress indicator and use thereof
  • Nucleic acid construct for expressing oxidative stress indicator and use thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0127] For the production of transgenic animals (excluding humans), for example, nuclear transfer method, differentiated pluripotent cells such as ES cells and iPS cells can be used.

[0128] In the present specification, "animal" includes animals other than humans, preferably birds, mammals, primates such as monkeys and chimpanzees, rodents such as mice, rats, and hamsters, cattle, goats, sheep, etc. useful as livestock animals. Artiodactyla such as pigs, Carnivora such as dogs and cats, birds such as chickens, etc.

[0129] The nuclear transfer method includes, for example, introducing the nucleic acid construct or vector of the present invention into the genome of a somatic cell such as a fibroblast, and then microinjecting the nucleus removed from the cell into an enucleated fertilized or unfertilized egg ( If it is an enucleated unfertilized egg (after applying electrical stimulation), it is transplanted into the uterus or fallopian tube of the adoptive mother to allow it...

Embodiment 1

[0165]

[0166] [Construction of plasmid]

[0167] To prepare p(3xARE)TKbasal, the ARE fragment amplified by PCR (derived from the mouse GSTYa promoter; ACTAGTACTAGTGGAAATGACATTGCTAATGGTGACAAAGCAACTTTTCTAGA (SEQ ID NO. 14); binding restriction sites are indicated in bold) was digested with SpeI-XbaI and self-ligated , to form a 3-time repeat fragment, and then inserted into pTKbasal with XbaI-SpeI sites. The XbaI-SpeI site is located at the 5' position of the TK basal promoter. Will encode people Nrf2( figure 1 1-93, 1-433, full-length (full-length) cDNA was amplified by PCR, and inserted into p(3xARE)TKbasal (or Image 6 pTKX). The cDNA encoding luciferase (GL4) was PCR amplified with a 1×Flag tag at its 3′ end and inserted into p(3xARE)TKbasal-hNrf2(1-433) with XhoI-NheI sites. The obtained p(3xARE)TKbasal-hNrf2(1-433)GL4-Flag was used as the OKD48-Luc plasmid. The GFP type, ie, p(3xARE)TKbasal-hNrf2(1-433)-Venus-Flag, was prepared by the same method and used as the O...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
strengthaaaaaaaaaa
Login to View More

Abstract

The invention provides a nucleic acid construct for expressing an oxidative stress indicator, comprising a nucleic acid sequence encoding a partial protein, which contains at least the Neh2 domain sequence and is obtained by substantially deleting or functionally deleting the Neh1 domain sequence or the Neh1-Neh3 domain sequence in Nrf2 protein, a stress-inducible promoter sequence, which is located upstream the nucleic acid sequence, and a nucleic acid sequence, which encodes a protein capable of emitting a detectable signal and is located downstream the nucleic acid sequence. The invention also provides a method for measuring oxidative stress and a method for screening an oxidative stress inhibitor, each using the nucleic acid construct.

Description

technical field [0001] The present invention relates to a nucleic acid construct for expressing an indicator of oxidative stress. Specifically, oxidative stress is stress related to the Nrf2-Keap1 pathway. [0002] The invention also relates to methods of measuring oxidative stress using the nucleic acid constructs described above. [0003] The present invention also relates to a method for screening an agent for suppressing oxidative stress using the above-mentioned nucleic acid construct. Background technique [0004] Oxidative stress refers to a state in which the balance of the generation and removal system of active oxygen species in the body is disturbed and active oxygen species are excessive. If this state continues, the nucleic acid, protein, lipid, etc. constituting the body will be oxidized, causing damage to the body. If cells are exposed to oxidative stress or electrophilic substances, they will participate in the body's defense by inducing the expression of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/09A01K67/027C12N1/15C12N1/19C12N1/21C12N5/10G01N21/78G01N33/15G01N33/50
CPCC07K14/82G01N2800/7009G01N21/359C07K14/4702A01K67/0275A01K2217/052A01K2227/105A01K2267/0393G01N33/5008A61K49/0008
Inventor 岩胁隆夫及川大辅
Owner RIKEN
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com