Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of wheat TaCPK2 protein in plant disease-resistant breeding

A technology of wheat and protein, applied in the field of genetic engineering, can solve the problem that the biological function of TaCPK2 is not clearly explained, and achieve the effect of increasing resistance

Inactive Publication Date: 2014-11-12
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although the wheat CDPK family has been reported (Li et al., 2008), the biological function of TaCPK2 has not been clearly elucidated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of wheat TaCPK2 protein in plant disease-resistant breeding
  • Application of wheat TaCPK2 protein in plant disease-resistant breeding
  • Application of wheat TaCPK2 protein in plant disease-resistant breeding

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Cloning of full-length gene of wheat calcium-dependent protein kinase TaCPK2

[0025] Use primers with restriction enzyme sites, forward primer GCAT ATGGGCAACGCATGCGGCGGT (as shown in SEQ ID No.4) and reverse primer GCAT CTAGATTGCACCAGGTGCGTC (as shown in SEQ ID No.5) clones the coding region sequence of TaCPK2 gene from the cDNA of Chinese spring wheat (Triticum aestivum L.) leaf;

[0026] PCR program: 94°C, 5 minutes; 94°C, 30 seconds; 55°C, 30 seconds; 72°C, 90 seconds; repeat 35 times; 72°C, 10 minutes.

[0027] PCR system: 2×EasyTaq PCR SuperMix (Quanshijin Company) 25μl;

[0028] Forward primer (10μM) 2μl;

[0029] Reverse primer (10μM) 2μl;

[0030] DNA template 5μl;

[0031] Double distilled water to make up 50μl.

[0032] After the PCR product was gel-cut, recovered and purified, it was cloned and connected to the pEASY-T1 Simple vector ( figure 1 ), the ligation product was transformed into Escherichia coli DH5α, and multiplied therein, and ...

Embodiment 2

[0033] Embodiment 2: Structural analysis of protein encoded by wheat calcium-dependent protein kinase gene TaCPK2

[0034] The structural analysis of the protein encoded by the wheat calcium-dependent protein kinase gene TaCPK2 showed that the protein encoded by this gene has the same conserved enzyme active site and structural domain as the CDPK protein domain in other plants. Phylogenetic analysis showed that the protein encoded by wheat TaCPK2 gene had the highest similarity with HvCDPK4 protein in barley, which was 95.9%. HvCDPK4 induces the spread of mesophyll cell death, which is not conducive to the invasion of fungi, and plays a role in resisting the invasion of powdery mildew. Therefore, the wheat TaCPK2 gene and the HvCDPK4 gene in barley have similar functions in resisting the invasion of powdery mildew.

Embodiment 3

[0035] Embodiment 3: VIGS vector and VIGS plant of wheat calcium-dependent protein kinase gene TaCPK2

[0036] Use primers with restriction enzyme sites, forward primers TGTCCTTTGATGGGCAACGCA (as shown in SEQ ID No.6) and reverse primer CCGCGTGGCCGTCCGTCTT (as shown in SEQ ID No.7) was amplified by PCR from the cDNA of Chinese spring wheat (Triticum aestivum L.) leaves, PCR program: 94°C, 5 minutes; 94°C, 30 seconds; 56°C, 30 seconds; 72°C, 30 seconds; repeat 35 times; 72°C, 10 minutes.

[0037]PCR system: 2×EasyTaq PCR SuperMix (Quanshijin Company) 25μl;

[0038] Forward primer (10μM) 2μl;

[0039] Reverse primer (10μM) 2μl;

[0040] DNA template 5μl;

[0041] Double distilled water to make up 50μl.

[0042] After the PCR products were gel-cut, recovered and purified, they were cloned and connected to the pEASY-T1 Simple vector ( figure 1 ), the ligation product was transformed into Escherichia coli DH5α, and multiplied therein, and the positive clone was sequenced a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a wheat TaCPK2 protein in plant disease-resistant breeding. The invention has the following advantages: a wheat TaCPK2 gene provided by the invention belongs to genes of the CDPK gene family participating in plant defense against causes of diseases, inhibition of expression of the TaCPK2 gene in wheat can obviously influence resistance of wheat to powdery mildew, and overexpression of the TaCPK2 gene in paddy rice can obviously improve resistance of transgenic rice to bacterial leaf blight; and the TaCPK2 gene can be used for overcoming the problem of decrease of output of plants caused by fungous or bacterial diseases like powdery mildew and bacterial leaf blight.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to the application of a calcium-dependent protein kinase gene in disease resistance engineering. Background technique [0002] In recent years, due to the extensive use of fungicides, although there have been no large-scale outbreaks of crop diseases, excessive reliance on pesticides has not only increased production costs, but also caused large-scale environmental pollution, seriously threatening agricultural ecological security. The most economical, safe and effective way to control the prevalence of crop diseases is to clone crop disease-resistant genes and apply them to crop disease-resistant genetic breeding by means of biotechnology. However, due to the interaction between disease-resistant genes and avirulent genes, the specific resistance of varieties to races is expressed, and plant disease resistance is often overcome by changes in the physiological races of pathogen pop...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/12C12N15/54C12N15/82A01H5/00
Inventor 毛龙李爱丽武亮汤丽川耿帅锋
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI