Dual gene for improving crop yield as well as encoding protein and application thereof
A dual-gene, gene technology, applied in the direction of plant gene improvement, application, plant products, etc., to achieve the effect of improving plant yield, promoting growth and development, and obvious growth and development
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Embodiment 1, the acquisition of rapeseed cy-fbpase gene fragment
[0052] Proceed as follows:
[0053] (1) Cloning of the cy-fbpase gene: Firstly, by comparing the known homologous sequences of the cy-fbpase gene, the conserved sequence of the gene was found, and primers were designed. Conserved sequence amplification primers are as follows:
[0054] F-1 GTTGTTTTTGATCCACTTGATGG (Seq ID No: 7)
[0055] R-1 GGCTTGCTCCATCAAGAACG (Seq ID No: 8)
[0056] Using rapeseed genomic DNA as template and F-1 and R-1 as primers (primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd.) for PCR amplification, the reaction system is as follows: 10×Taq DNA Polymerase Buffer 5μL, dNTP Mix (10mM) 2 μL, F-1 (10 μM) 1 μL, R-1 (10 μM) 1 μL, genomic DNA (50 ng / μL) 1 μL, Taq DNA polymerase (Taq DNA polymerase was purchased from TaKaRa Company, the same below) 0.5 μL, ddH 2 O39.5 μL, a total of 50 μL. PCR reaction conditions: 94°C for 5min; 94°C for 30s, 56°C for 30s, 72°C for...
Embodiment 2
[0062] The construction of embodiment 2, cy-fbpase gene expression vector
[0063] Proceed as follows:
[0064] (1) In order to avoid the restriction site contained in the target gene being cut during the vector construction process, the cDNA sequence of the rapeseed cy-fbpase gene was analyzed by the software Vector NT1, and the 173bp site of the rapeseed cy-fbpase gene was divided by G changed to A, changed from G to G at the 258th position, and changed from A to G at the 374th position. Although the codon changed, the encoded amino acid did not change. These three point mutations were obtained by using rapeseed cDNA as the substrate , performing site-directed mutagenesis by stacking extension PCR method, the sequence obtained after site-directed mutagenesis is shown in SEQ ID No: 4 (the gene is still referred to as cy-fbpase hereinafter).
[0065] (2) Construction of the intermediate vector: PstI and XhoI (restriction enzymes were purchased from Fermentas, the same below) ...
Embodiment 3
[0067] The cloning of embodiment 3, SBPase gene fragment
[0068] (1) The conserved sequence of the SBPase gene: The primer pair for PCR amplification of the SBPase gene was designed according to the conserved sequence of the SBPase gene. The designed primers were SBP-F and SBP-R. F and SBP-R were used as primers for PCR amplification, and the conserved sequences and degenerate primer sequences were as follows:
[0069] SBP-F GGGAATTCGATGTGYATGGGAGAAGCWTTG (SEQ ID No: 11)
[0070] SBP-RGGAAGCTTGGMACCATTCCTCCRGTGTATC (SEQ ID No: 12)
[0071] Reaction system for PCR amplification of conserved sequences (50 μL): 5 μL of 10X Taq DNA polymerase buffer, 2 μL of dNTP Mix (10 mM), 1 μL of SBP-F (10 μM), 1 μL of SBP-R (10 μM), 1 μL of rapeseed genomic DNA, Taq DNA polymerase 0.5 μL, ddH 2 O39.5 μL. PCR reaction program: 94°C for 5min; 30 cycles of 94°C for 30s, 63°C for 30s, 72°C for 1min; 72°C for 8min. Electrophoresis detection: Prepare 1% agarose gel, electrophoresis at 100V volt...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com