Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant human pepsinogen II isozyme chimeric protein, and preparation method and applications thereof

A pepsinogen and chimeric protein technology, applied in the field of preparation of recombinant human pepsinogen II isoenzyme chimeric protein, can solve the problems of incomplete consistency, lack, and unreported problems, and achieve the effect of improving the capture rate

Active Publication Date: 2013-11-13
常州爱复康生物科技有限公司
View PDF3 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, there are two isoenzymes of pepsinogen PG II, which differ in amino acid sequence and are not completely identical. Therefore, in the pepsinogen diagnostic kit, the reagents based on polyclonal antibodies may lack some antibodies against other enzymes. A polyclonal antibody against one isozyme, while a more sensitive monoclonal antibody against another isozyme may be lacking in reagents that use monoclonal antibodies as raw materials
In the existing literature records, it has never been reported that it is used to prepare pepsinogen II chimeric protein that can simultaneously produce polyclonal antibodies against these two isozymes or can simultaneously screen monoclonal antibodies against two isozymes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant human pepsinogen II isozyme chimeric protein, and preparation method and applications thereof
  • Recombinant human pepsinogen II isozyme chimeric protein, and preparation method and applications thereof
  • Recombinant human pepsinogen II isozyme chimeric protein, and preparation method and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Preparation of recombinant human pepsinogen II isozyme chimeric protein, such as figure 1 as shown, figure 1 It is a flowchart of preparing recombinant human pepsinogen II isozyme chimeric protein in Example 1 of the present invention.

[0052] (1) Artificially synthesized human pepsinogen II isozyme gene sequence

[0053] According to the reported two isozyme gene sequences of human pepsinogen II, gene optimization is carried out, and the two isozyme gene sequences are synthesized respectively. The nucleotide sequence of isozyme 1 is SEQ ID NO7, and the nucleotide sequence of isozyme 2 is SEQ ID NO8.

[0054] (2) PCR splicing human pepsinogen II isozyme chimeric protein gene sequence

[0055] According to the already synthesized two isozyme gene sequences, the upstream primer of human pepsinogen II isozyme 1 was designed: P1:5, TTCCATGGCAGTTGTCAAAGTTCCACTGAAGAAGTTT3, and the downstream primer: P2:5, GCTTCCACCGCCGCCTGCAGCAGTAGCGAAAC3,. Human pepsinogen II isozyme 2 ...

Embodiment 2

[0075] Preparation of Human Pepsinogen II Kit Calibrator

[0076] The recombinant human pepsinogen II isozyme chimeric protein prepared in Example 1 was tested by Beijing Jiuqiang Biological Company detection kit, and diluted to 10mg with diluent (20mM PB, 150mM NaCl, 1%BSA pH7.4) / l made of calibrator. Then determine with different dilution concentration protein (such as Figure 5 shown, respectively 5ng / ml, 15ng / ml, 30ng / ml, 60ng / ml, 100ng / ml), the calibration curve was prepared, and the results are shown in Figure 5 , Figure 5 It is the calibration curve diagram of the recombinant chimeric protein in Example 2 of the present invention.

[0077] Based on this calibration curve, take 10 samples, after measurement, the actual measured value and the theoretical value data are as follows: Figure 6 as shown, Figure 6 It is the actual measured value and theoretical value data evaluation result of the sample in Example 2 of the present invention. Regression equation R 2 ...

Embodiment 3

[0079] Preparation of goat polyantiserum against two isozymes of human pepsinogen II

[0080] Three healthy goats aged 4-6 months and weighing 25 kg were used as immune animals. The recombinant human pepsinogen II isozyme chimeric protein prepared in Example 1 was used as the immunogen for immunization. Immunization dose: basic immunization is 3mg / monkey, booster immunization dose is 4mg / bird.

[0081] The specific immunization steps are as follows: Dilute an appropriate amount of immunogen with a diluent, add an equal volume of Freund’s complete adjuvant, fully emulsify, and inject multiple points into the skin of the sheep’s back for the first immunization; two weeks later, take the antigen and add Freund’s incomplete adjuvant After fully emulsified, multi-point subcutaneous injections on the back, booster immunization once every two weeks, starting from the third booster immunization, blood collection on the seventh day after each immunization to test the titer, after the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant human pepsinogen II isozyme chimeric protein, and a preparation method and applications thereof. The preparation method comprises the steps as follows: by taking gene sequences of two isozymes of recombinant human pepsinogen II as a template, carrying out PCR (polymerase chain reaction) splicing to obtain a chimeric protein coding gene sequence, constructing recombinant expression plasmids, transforming the screened positive clone plasmids into expression host cells, screening an efficiently-expressed recombinant chimeric protein strain, carrying out enlargement culture on the cells and inducing expression chimeric protein, and purifying to obtain the recombinant human pepsinogen II isozyme chimeric protein. The invention further discloses the applications of the recombinant human pepsinogen II isozyme chimeric protein in preparing monoclonal antibodies and multiresistant serums or pepsinogen II kit calibration products. A great amount of stably expressed recombinant human pepsinogen II isozyme chimeric protein can be produced by utilizing a genetic engineering technology, and one protein has two chimeric protein sequences of the human pepsinogen II.

Description

technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a recombinant human pepsinogen II isozyme chimeric protein, a preparation method and an application thereof. Background technique [0002] Pepsinogen (PG) is a proteolytic zymogen secreted by gastric mucosal cells, which belongs to the aspartic proteinase family. Under acidic conditions with a pH of 1.0-5.0, it can be automatically hydrolyzed into pepsin. According to the biochemical and immunological characteristics, it can be divided into two categories: PG I (PGA) and PG II (PGC). There are 7 groups of pepsin isoenzymes. Secreted by the mucus neck cells of the principal cells of the gastric glands; components 6 to 7 are called PG II, derived from the oxyntic glands of the gastric fundus mucosa of the gastric body, gastric cardia glands, gastric antrum pyloric glands and distal duodenal Brunner's glands, The prostate and pancreas also produce small amounts. Most of th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/64C12N15/57C12N15/70C07K16/40C07K16/06G01N33/573
Inventor 连小冬张炯陈智峰孙环嵘
Owner 常州爱复康生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More