Recombinant human pepsinogen II isozyme chimeric protein, and preparation method and applications thereof
A pepsinogen and chimeric protein technology, applied in the field of preparation of recombinant human pepsinogen II isoenzyme chimeric protein, can solve the problems of incomplete consistency, lack, and unreported problems, and achieve the effect of improving the capture rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Preparation of recombinant human pepsinogen II isozyme chimeric protein, such as figure 1 as shown, figure 1 It is a flowchart of preparing recombinant human pepsinogen II isozyme chimeric protein in Example 1 of the present invention.
[0052] (1) Artificially synthesized human pepsinogen II isozyme gene sequence
[0053] According to the reported two isozyme gene sequences of human pepsinogen II, gene optimization is carried out, and the two isozyme gene sequences are synthesized respectively. The nucleotide sequence of isozyme 1 is SEQ ID NO7, and the nucleotide sequence of isozyme 2 is SEQ ID NO8.
[0054] (2) PCR splicing human pepsinogen II isozyme chimeric protein gene sequence
[0055] According to the already synthesized two isozyme gene sequences, the upstream primer of human pepsinogen II isozyme 1 was designed: P1:5, TTCCATGGCAGTTGTCAAAGTTCCACTGAAGAAGTTT3, and the downstream primer: P2:5, GCTTCCACCGCCGCCTGCAGCAGTAGCGAAAC3,. Human pepsinogen II isozyme 2 ...
Embodiment 2
[0075] Preparation of Human Pepsinogen II Kit Calibrator
[0076] The recombinant human pepsinogen II isozyme chimeric protein prepared in Example 1 was tested by Beijing Jiuqiang Biological Company detection kit, and diluted to 10mg with diluent (20mM PB, 150mM NaCl, 1%BSA pH7.4) / l made of calibrator. Then determine with different dilution concentration protein (such as Figure 5 shown, respectively 5ng / ml, 15ng / ml, 30ng / ml, 60ng / ml, 100ng / ml), the calibration curve was prepared, and the results are shown in Figure 5 , Figure 5 It is the calibration curve diagram of the recombinant chimeric protein in Example 2 of the present invention.
[0077] Based on this calibration curve, take 10 samples, after measurement, the actual measured value and the theoretical value data are as follows: Figure 6 as shown, Figure 6 It is the actual measured value and theoretical value data evaluation result of the sample in Example 2 of the present invention. Regression equation R 2 ...
Embodiment 3
[0079] Preparation of goat polyantiserum against two isozymes of human pepsinogen II
[0080] Three healthy goats aged 4-6 months and weighing 25 kg were used as immune animals. The recombinant human pepsinogen II isozyme chimeric protein prepared in Example 1 was used as the immunogen for immunization. Immunization dose: basic immunization is 3mg / monkey, booster immunization dose is 4mg / bird.
[0081] The specific immunization steps are as follows: Dilute an appropriate amount of immunogen with a diluent, add an equal volume of Freund’s complete adjuvant, fully emulsify, and inject multiple points into the skin of the sheep’s back for the first immunization; two weeks later, take the antigen and add Freund’s incomplete adjuvant After fully emulsified, multi-point subcutaneous injections on the back, booster immunization once every two weeks, starting from the third booster immunization, blood collection on the seventh day after each immunization to test the titer, after the ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


