Genetically engineered bacterium for producing acetoin as well as construction method and application thereof

A technology of genetically engineered bacteria and hydroxybutanone, which is applied in the directions of genetic engineering, microorganism-based methods, applications, etc., can solve the problems of not increasing the yield of 3-hydroxybutanone, and achieve the effects of increasing yield and improving economic benefits.

Active Publication Date: 2013-12-11
NANJING UNIV OF TECH
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, neither the expression of its own ALS nor the ALS of Bacillus subtilis in Clostridium acetobutylicum showed an increase in 3-hydroxybutanone production (Wardwell, S.A. Metabolism of acetoin in C. acetobutylicum ATCC824. Rice University. 1999)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically engineered bacterium for producing acetoin as well as construction method and application thereof
  • Genetically engineered bacterium for producing acetoin as well as construction method and application thereof
  • Genetically engineered bacterium for producing acetoin as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Construction of Clostridium acetobutylicum containing the expression plasmid of the acetolactate decarboxylase gene CAC2967.

[0037] The bacterial genome kit was used to extract the genomic DNA of Clostridium acetobutylicum ATCC824 in the middle and late stages of logarithmic growth, and the acetolactate decarboxylase gene CAC2967 was amplified by PCR with the following primers:

[0038] ALDC-s CATATG ATTGAAGAAGTGATCCCTAATCAT (the underlined part is the NdeI recognition site);

[0039] ALDC—as GAAATAAGTAAAGTTGAGAAATAA CATATG (The underlined part is the NdeI recognition site).

[0040] The high-efficiency fidelity enzyme Primerstart of TAKARA Company was used for PCR amplification, and the amplification program was: 95°C for 3min; 98°C for 10s, 55°C for 15s, 72°C for 1min, 30 cycles; 72°C for 10min. After the PCR product was sequenced, its sequence was determined as shown in SEQ ID No:1.

[0041] After the obtained PCR product was purified and recovered...

Embodiment 2

[0044] Example 2: Construction of Clostridium acetobutylicum containing the expression plasmid of the acetolactate decarboxylase gene BSU36000.

[0045] Bacillus subtilis CGMCC No.3720 (recorded in Chinese patent 201010171377.5) was extracted using a bacterial genome kit. The acetolactate decarboxylase gene BSU36000 was amplified by PCR with the following primers:

[0046] BSU36000-s CATATG ATGAAACGAGAAAGCAACATTC (the underlined part is the NdeI recognition site);

[0047] BSU36000-as TGAAGGAAGCCCTGAATAA CATATG (The underlined part is the NdeI recognition site). The sequence of the amplified product is determined as shown in SEQ ID No:2 after sequencing. The amplified product was introduced into Clostridium acetobutylicum according to the method in Example 1 to obtain a recombinant Clostridium acetobutylicum containing the pIMP1-BSU36000 plasmid, which was named C. acetobutylicum B3 (pIMP1-BSU36000).

Embodiment 3

[0048] Example 3: Fermentative production of ABE and 3-hydroxybutanone by genetically engineered bacteria.

[0049] Fusobacterium acetobutylicum (C. acetobutylicum) B3 (pIMP1-ALDC) and B3 (pIMP1-BSU36000) were cultured statically at 37°C for 12 hours in P2 seed medium (without adding agar, and other components were the same as P2 plate medium). They were inoculated into the fermentation medium at an inoculum size of 10% (v / v). The formula of the fermentation medium is as follows: K 2 HPO 4 0.5g / L;KH 2 PO 4 0.5g / L;CH 3 COONH 4 2.2g / L; MgSO4 ·7H 2 O0.2g / L;MnSO 4 ·H 2 O0.01g / L; NaCl0.01g / L; FeSO 4 ·7H 2 O0.01g / L; p-aminobenzoic acid 1mg / L; thiamine 1mg / L; biotin 0.01mg / L. Anaerobic fermentation at 37°C for 60h. The components of the fermentation broth were detected by gas chromatography, and the detection conditions of gas chromatography were as follows: flame ion detector (FID), Agilent HP-INNOWAX19091N-236 capillary column (60m×0.25mm×0.25um), N2 as carrier gas, flo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a genetically engineered bacterium for producing acetoin. The genetically engineered bacterium is clostridium into which a coding gene of acetolactate decarboxylic reaction enzyme is imported. The invention also discloses a construction method and an application of the genetically engineered bacterium. By adopting the method, the average yield of acetoin produced from clostridium acetobutylicum is about 5g / L.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a genetically engineered bacterium with high yield of 3-hydroxybutanone and its construction method and application. Background technique [0002] 3-Hydroxybutanone, also known as acetoin and acetylmethylmethanol, is usually a light yellow liquid or crystal, naturally occurring in corn, grapes, strawberries, cheese, meat and other foods, and is a widely used Spices, my country's national standard GB2760-86 stipulates that it is an edible spice that is allowed to be used, and the safety number of the American Food and Extraction Association (FEMA) is 2008. In addition, 3-hydroxybutanone can also be used as an important raw material in chemical synthesis, for example, it can be used to synthesize chiral smectic materials and nematic materials. [0003] The traditional chemical preparation of 3-hydroxybutanone is mainly through chemical or enzymatic conversion, an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/60C12P7/26C12R1/145
Inventor应汉杰丁凤英陈勇柳东郭亭谢婧婧
OwnerNANJING UNIV OF TECH