Construction method of bacterial ghost carrier

A construction method and carrier technology, applied in the field of genetic engineering, can solve problems such as interfering with the expression of cleavage gene E

Active Publication Date: 2013-12-11
HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, researchers use anchor proteins to fix target proteins on the bacterial inner membrane to prepare bacteriostas. The cleavage gene E, anchor sequence and target protein are expressed in tandem, which has requirements for the size and spatial structure of the target protein. , and the spatial structure of the target protein in series with the anchor sequence may interfere with the expression of the cleavage gene E

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of bacterial ghost carrier
  • Construction method of bacterial ghost carrier
  • Construction method of bacterial ghost carrier

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Preparation of Escherichia coli ghosts with pBV220 as carrier

[0045] 1. Design and synthesis of E gene

[0046] Using Oligo6.0 and primer5.0 software, primers were designed according to the coding sequence of phage PhiX174 cleavage gene E (NC-001422) registered in GenBank. A restriction enzyme cutting site EcoRI was introduced at the 5' end of the upstream primer, a restriction enzyme cutting site Sal I restriction enzyme cutting site was introduced at the downstream 5' end, and several protective bases were randomly added at both ends. The primers were synthesized by Shanghai Sangong Synthesis Department.

[0047] E upstream primer E1: 5'-CGC GAATTCATGGTACGCTGGACTTTGT G-3', the sequence in the underline is the restriction enzyme cutting site EcoRI enzyme cutting site.

[0048] E downstream primer E2: 5′-ACG CGTCGA CTCACTCCTTCCGCACG TAAT-3', the underlined sequence is the restriction enzyme cutting site Sal I enzyme cutting site.

[0049] 2. PCR ampli...

Embodiment 2

[0065] The construction of embodiment 2 recombinant plasmid E '-OmpH-pET28a

[0066] 1. Design and synthesis of primers

[0067] Since the two genes are connected in series using the overlap PCR method, two pairs of overlapping complementary primers are designed according to the constructed recombinant plasmids pBV220-E and OmpH, and a BamH I restriction enzyme site is introduced at the 5' end of the upstream primer F1 (underlined), and the 3' end of the downstream primer K2 was introduced with an XhoI restriction enzyme site (underlined). Using the recombinant prokaryotic expression plasmid pBV220-E as a template, primers F1 and F2 amplify the anchor gene E', using the genome of Pasteurella CVCC393 as a template, primers K1 and K2 amplify the OmpH gene, and then use primers F1 and K2 to amplify E'-OmpH fusion gene. The nucleotide sequences of the primers are as follows:

[0068] E'upstream primer F1: 5'-CGCGGATCCATGGTACGCTGGACTTTGTG-3'

[0069] E' downstream primer F2: 5'...

Embodiment 3

[0093] Example 3 Construction and expression of bidirectional expression vector E'-OmpH-pET28a-ci857-E-T1T2

[0094] 1. Primer design and synthesis

[0095] According to the published gene sequence of the expression system of pBV220, the application software Primer5.0 and Oligo6.0 were used to obtain the repressor protein ci857, E gene and terminator T of pBV220 1 T 2 Design a pair of primers C1 and T1 for the template to amplify the cleavage system ci857-E-T1T2 gene, introduce a SgrAI restriction endonuclease site (underlined part) at the 5' end of the upstream primer, and introduce a SphI restriction site at the 5' end of the downstream primer endonuclease site. Primers were synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.

[0096] The nucleotide sequences of the primers are as follows:

[0097] ci857 upstream primer C1: 5'-TACATACrCCGGyGTCAGCCAA ACGTCTCTTC-3'(SgrAI)

[0098] T1T2 downstream primer T1: 5'-ACATGCATGCGTTTGTAGAAACG CAAAAAGG-3'(Sph...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a construction method of a bacterial ghost carrier. The bacterial ghost carrier comprises anchor gene E', pasteurella OmpH gene, a lysate box (all sequences of pBV220-E from repressor proteins to terminators) and plasmid vector pET28a. The lysate box (ci857-E-T1T2) of the bacterial ghost carrier exists in a non-multiple cloning site zone of pET28a independently so as to form an expression system, the expression system and an original expression system of pET28a are independent with each other, and the directions of the two expression systems are opposite, so that it is convenient for insertion of target protein genes in a multiple cloning site zone of pET28a, conformation of the target protein is not influenced by protein expression, and false translation is difficult to occur.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for constructing a ghost vector. Background technique [0002] Bacterial shadows are caused by the cleavage protein expressed by the bacteriophage cleavage gene E in Gram-negative bacteria, causing small holes of 40nm-200nm to appear on the inner and outer membranes of the bacteria, and the contents of the bacteria overflow due to osmotic pressure. shell. During the production process, the ghost vaccine is less damaged by physical and chemical factors, basically maintains the natural structure of the immunogen, and can be used as a good immunogen to protect animals. In foreign countries, bacterial shadow vaccines will soon enter the market as multi-linkage vaccines and multivalent vaccines, but in China, the research on bacterial sloughs, especially as a transport carrier, has just started, and there are still many problems that need to be studied and discussed. [0...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/70C12N15/66C12N1/21C12R1/19
Inventor朱战波姜东君于立权崔玉东王鹤梁宏儒赵达胡旭高佳滨陈为宏尹辉乔波陈楠楠
OwnerHEILONGJIANG BAYI AGRICULTURAL UNIVERSITY