MicroRNA sequencing kit and its application
A technique for sequencing and sequencing primers, which is applied in the field of molecular biology, can solve problems such as the absence of microRNA gene polymorphism detection methods, and achieve the effects of accurate detection and interpretation and high primer efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment approach
[0063] The above kit and detection method will be described in detail below in conjunction with the examples.
[0064] A primer design
[0065] Using NCBI ( www.ncbi.nlm.nih.gov ) GenBank target sequence site and about 500bp genome sequence around it. Use the software "AssayDesign" attached to the pyrosequencer to design PCR amplification primers for single nucleotide polymorphism sites and pyrosequencing primers, and select the primer pair with the highest score. The designed primers were synthesized by Shanghai Bioengineering Co., Ltd., and one of the PCR primers was modified with biotin at the 5' end.
[0066] 1) Combination 1: has-miR-146ars2910164 and has-miR-608rs4919510
[0067] has-miR-146ars2910164
[0068] Upstream primer: 5'accatctctgaaaagccgatgt3'
[0069] Downstream primer: bio-5'caagcccacgatgacagagatat3'
[0070] has-miR-608rs4919510C / G
[0071] Upstream primer: bio-5'gccagcctggacaatataatgagact3'
[0072] Downstream primer: 5' gcagcctttgatggaagctctt3'
...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 