Unlock instant, AI-driven research and patent intelligence for your innovation.

MicroRNA sequencing kit and its application

A technique for sequencing and sequencing primers, which is applied in the field of molecular biology, can solve problems such as the absence of microRNA gene polymorphism detection methods, and achieve the effects of accurate detection and interpretation and high primer efficiency

Inactive Publication Date: 2016-05-18
THE THIRD AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIV OF PLA
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no microRNA gene polymorphism detection method based on pyrosequencing technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MicroRNA sequencing kit and its application
  • MicroRNA sequencing kit and its application
  • MicroRNA sequencing kit and its application

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach

[0063] The above kit and detection method will be described in detail below in conjunction with the examples.

[0064] A primer design

[0065] Using NCBI ( www.ncbi.nlm.nih.gov ) GenBank target sequence site and about 500bp genome sequence around it. Use the software "AssayDesign" attached to the pyrosequencer to design PCR amplification primers for single nucleotide polymorphism sites and pyrosequencing primers, and select the primer pair with the highest score. The designed primers were synthesized by Shanghai Bioengineering Co., Ltd., and one of the PCR primers was modified with biotin at the 5' end.

[0066] 1) Combination 1: has-miR-146ars2910164 and has-miR-608rs4919510

[0067] has-miR-146ars2910164

[0068] Upstream primer: 5'accatctctgaaaagccgatgt3'

[0069] Downstream primer: bio-5'caagcccacgatgacagagatat3'

[0070] has-miR-608rs4919510C / G

[0071] Upstream primer: bio-5'gccagcctggacaatataatgagact3'

[0072] Downstream primer: 5' gcagcctttgatggaagctctt3'

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biology, especially relates to the detection technology of nucleic acid, and specifically relates to a micro RNA sequencing method. The method comprises the following steps: designing a specific amplification primer of micro RNA to be detected and a pyrophosphoric acid sequencing primer of micro RNA to be detected according to the target points, one primer of the amplification primers being labeled by biotin; extracting the DNA of a sample to be detected, carrying out PCR amplification reactions by using the amplification primer so as to obtain an amplified primer, wherein any one strain of the specific amplification primer is labeled by biotin; separating the PCR amplified substance into single chains by adopting an alkaline denaturation method, purifying the biotin labeled single-chain PCR amplified product, then subjecting the biotin labeled single-chain PCR amplified product to carry out hybridization reactions with the sequencing primer, and analyzing the result. The micro RNA target sequence selected by the invention and the kit containing the same can achieve the goals of rapid, convenient, accurate, high efficient, practical and economic detection of micro RNA gene type, fulfill the needs of actual work of clinical detection, and help to forecast the occurrence and development risk of diseases through the utilization of micro RNA gene detection.

Description

technical field [0001] The invention belongs to the field of molecular biology, and in particular relates to a kit and a method suitable for detecting microRNA gene polymorphisms by double PCR and double pyrosequencing methods. Background technique [0002] microRNA is a kind of small RNA molecule with highly evolutionary conservation, endogenous expression, single-stranded non-coding, about 18-25 nucleotides (nucleotident) in length. MicroRNA can cause target molecule mRNA degradation or translation inhibition through complementary matching with the target molecule mRNA sequence 3'-UTR, 5'UTR and open reading frame, and regulate the expression and activity of human functional genes. microRNA is an important post-transcriptional regulator, which plays an important role in physiological processes such as cell proliferation, differentiation and apoptosis, stress resistance, and fat metabolism. The imbalance of microRNA expression is involved in the occurrence and development o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/686C12Q1/6869C12Q2525/207C12Q2537/143C12Q2565/301C12Q2531/113
Inventor 张安强蒋建新顾玮曾灵杨策
Owner THE THIRD AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIV OF PLA