Cell strain capable of stably secreting and expressing IL-24 recombinant protein, and construction and application thereof

A technology of IL-24 and recombinant protein, applied in interleukin, medical preparations containing active ingredients, cells modified by introducing foreign genetic material, etc.

Inactive Publication Date: 2014-04-09
AFFILIATED HOSPITAL CHINA ACADEMY OF MILITARY MEDICAL SCI +1
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although IL-24 recombinant protein has obvious anti-tumor effect, there is no report on its application in clinical tumor treatment research.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cell strain capable of stably secreting and expressing IL-24 recombinant protein, and construction and application thereof
  • Cell strain capable of stably secreting and expressing IL-24 recombinant protein, and construction and application thereof
  • Cell strain capable of stably secreting and expressing IL-24 recombinant protein, and construction and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Establishment and identification of secretory expression cell lines

[0033] (1) Construction of IL-24 recombinant expression vector:

[0034] Primers were designed according to the human IL-24 gene sequence (gi: 1141750) recorded in GenBank to amplify its CDS region sequence. The primer sequences were as follows: the upstream primer was 5'cccaagcttaatgaattttcaacagagg3', and the downstream primer was 5'ggggtaccttaatgatgatgatgatgatgagaaccgcgtggcaccaggtacccgttgagcttgtagaatttctg3'. HindⅢ and KpnI nucleic acid restriction sites were introduced into the upstream and downstream primers respectively, and the His6-tag sequence atgatgatgatgatgatg and the protease Thrombin restriction site ctggtgccacgcgttct were introduced at the 5' end of the downstream primers. The PCR system is as follows: 5×primeSTAR Buffer10ul, dNTP4ul, 10μM upstream and downstream primers 1μl each, the template is the IL-24 recombinant expression vector pcDNA3-IL-24, see [Ma Qunfeng, Jiang Hong, Liu Kun, Zh...

Embodiment 2

[0040] Purification and Identification of IL-24 Recombinant Protein

[0041] (1) Comparison of IL-24 recombinant protein secreted and expressed by site-directed integration cell line FCHO / IL-24 and non-site-directed integration cell line

[0042] In order to compare and analyze the effects of cDNA site-specific integration or non-site-specific integration of IL-24 in the genome of engineered cell lines on the secretion and expression level of IL-24 recombinant protein, we will be able to stably secrete and express IL-24 recombinant protein. A site-specific integration engineered cell line (FCHO / IL-24) and three non-site-specific integration cell lines (HEK293 / pSecTag2A-IL-24, HEK293 / pcDNA3.1myc / His-IL-24 and HEK293 / pCEP4-IL-24) according to 1.5×10 6 The number of cells was inoculated in a 10 cm culture dish, 15 mL of culture medium was added, and 0.3 mL of supernatant was collected on the 1st, 2nd, 3rd, and 4th days of subculture, and the expression level of IL-24 recombinant ...

Embodiment 3

[0048] Detection of anti-tumor activity of recombinant protein in vivo and in vitro

[0049] (1) Detection of the ability of IL-24 recombinant protein to inhibit the proliferation of tumor cells in vitro

[0050]The survival rate of cells treated with IL-24 recombinant protein was detected by MTT method [Cancer Research, 2006, 66(24): 11869-11877]. The specific steps were as follows: melanoma A375 cells, esophageal cancer Eca-109 cells, lung cancer cells A549 cells and normal human embryonic lung fibroblasts HEL were plated into 96-well plates at an amount of 2500 cells / well, and after 24 hours of cell culture, IL-24 recombinant protein at different concentrations were added (final concentrations were 0, 1, 5, 10, 20, and 50ng / mL), after 4 days of action, add 20μl of MTT (5mg / mL) to each well, incubate at 37°C for 4 hours, absorb the liquid, add 150μl of DMSO to dissolve the precipitate, and measure the absorbance at 492nm. All experiments were repeated three times, and the r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a cell strain capable of stably secreting and expressing IL-24 recombinant protein, and construction and application thereof, belonging to the technical field of gene engineering. The construction method of the cell strain comprises the following steps: subcloning CDS region sequence of IL-24 gene into pcDNA5/FRT plasmid of an Flp-In targeted integration system, transfecting into Flp-In-CHO cell together with plasmid pOG44, and screening the stable-expression cell strain by using antibiotic Hygromycin B; purifying the recombinant protein in the cultured supernatant of the cell strain by affinity chromatography; and finally, carrying out in-vivo and in-vitro activity experiments to prove that the recombinant protein has an action on inhibiting esophagus cancer cells and melanoma cells from proliferation and can induce the apoptosis of the esophagus cancer cells and melanoma cells, thereby developing an effective new drug for treating tumors.

Description

technical field [0001] The invention belongs to the technical field of tumor biotherapy, and in particular relates to a cell line stably secreting and expressing IL-24 recombinant protein and its construction and application. Background technique [0002] Mda-7 / IL-24 was identified by subtractive hybridization after treating human melanoma cells (H0-1) with recombinant human IFN-β and mezerein (MEZ) in the laboratory of Professor Fisher PB of Columbia University in the United States in 1995 (Interleukin 24). Its distribution is highly restricted, limited to the immune system (e.g. spleen, thymus, peripheral blood leukocytes) and specific cells (e.g. melanocytes, moles, early melanoma cells, smooth muscle cells, skin fibroblasts, skin wound edges and Basal fibroblast-like cells), the expression of IL-24 protein was not detected in more than 50 kinds of tumor cells. [0003] Nearly 18 years of research have shown that IL-24 is an anti-tumor "star" molecule. First of all, it...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/63A61K35/54A61K38/20A61P35/00C07K14/54A61K35/12
Inventor 马群风江红郑晓飞金邦明张耀史亦南曹宇宋何煜张驰邓学峰王字玲
Owner AFFILIATED HOSPITAL CHINA ACADEMY OF MILITARY MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap