A set of probes for the detection of bacillus species
A Bacillus genus and detection probe technology, applied in the field of nucleic acid detection, can solve the problems of an efficient detection method for Bacillus genus bacteria, difficult sampling and processing of Daqu and wine grains, etc., and achieves clever design and improved detection accuracy. , high specificity effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0026] In order to understand the technical content of the present invention more clearly, the following examples are given in detail for the purpose of better understanding the content of the present invention rather than limiting the protection scope of the present invention. In this example, specific probes were used for Bacillus ( Bacillus ) bacteria were detected, their standard curve was made, and their specificity was verified.
[0027] 1.1 Design and synthesis of probes for specific regions of Bacillus 16S rRNA
[0028] Compare the 16S rRNA conserved sequences of all species of Bacillus in Genbank, find the conserved sequence of Bacillus, and perform Blastn analysis to determine that the 915-975 region is the specific sequence of Bacillus, and it is different from other The nucleotide has no homology, and it is determined as a characteristic region. The design analysis probe is: 5'-AACGCTTGCC ACCTACGTATTACCGCGGCT GCTGGCACGT
[0029] AGTTAGCCGT GGCTTTCTGG T-3' (see th...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com