Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A set of probes for the detection of bacillus species

A Bacillus genus and detection probe technology, applied in the field of nucleic acid detection, can solve the problems of an efficient detection method for Bacillus genus bacteria, difficult sampling and processing of Daqu and wine grains, etc., and achieves clever design and improved detection accuracy. , high specificity effect

Active Publication Date: 2017-01-11
JIANGNAN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, due to the variety of microorganisms in traditional fermentation such as liquor, and the difficulty in sampling and processing Daqu and fermented grains, there is no efficient detection method for direct detection of Bacillus bacteria in samples using molecular probes.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A set of probes for the detection of bacillus species
  • A set of probes for the detection of bacillus species

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0026] In order to understand the technical content of the present invention more clearly, the following examples are given in detail for the purpose of better understanding the content of the present invention rather than limiting the protection scope of the present invention. In this example, specific probes were used for Bacillus ( Bacillus ) bacteria were detected, their standard curve was made, and their specificity was verified.

[0027] 1.1 Design and synthesis of probes for specific regions of Bacillus 16S rRNA

[0028] Compare the 16S rRNA conserved sequences of all species of Bacillus in Genbank, find the conserved sequence of Bacillus, and perform Blastn analysis to determine that the 915-975 region is the specific sequence of Bacillus, and it is different from other The nucleotide has no homology, and it is determined as a characteristic region. The design analysis probe is: 5'-AACGCTTGCC ACCTACGTATTACCGCGGCT GCTGGCACGT

[0029] AGTTAGCCGT GGCTTTCTGG T-3' (see th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a detection probe of a group of bacillus ((i) Bacillus ( / i)) strains and belongs to the field of nucleic acid detection. The detection probe comprises three oligonucleotide probes which are correlated with one another, namely, an analysis probe which is specifically bonded with 16SrRNA (Ribose Nucleic Acid) of the bacillus, a capture probe which is bonded on a carrier and specifically bonded with the analysis probe, and a signal probe which is specifically bonded with the analysis probe, wherein the analysis probe has the nucleotide sequence shown in SEQ ID NO:1; the capture probe has a nucleotide sequence which is shown in SEQ ID NO:2 and provided with biotin marks; the signal probe has the nucleotide sequence shown in SEQ ID NO:3; and the 5' end of the nucleotide sequence of the signal probe is provided with fluorescein isothiocyanate (FITC) marks. If the strain concentration of the (i) B.subtilis ( / i) strains in a culture solution per milliliter is within 1.33*10<2>- 2.13*10<5>, the strain concentration is linearly correlated with the strength of detection signals, wherein R2=0.99741. In addition, the detection probe is good in specificity, high in sensitivity, high in stability, qualitative and quantitative. Thus, the detection probe can be applied to the real-time monitoring of the bacillus during the traditional fermentation production process of white wine and the like.

Description

technical field [0001] A group of Bacillus of the present invention ( Bacillus ) strain detection probes, specifically for the Bacillus genus ( Bacillus ) is a specific detection probe for qualitative and quantitative detection, and belongs to the field of nucleic acid detection. Background technique [0002] Bacillus bacteria can grow at high temperature, aerobic or facultative anaerobic, so in the special environment of high temperature and anaerobic in the liquor brewing process, Bacillus can multiply in large numbers, and Bacillus has a certain ability to hydrolyze protein and starch, Therefore, Bacillus is the dominant strain in the brewing process of liquor, and has an important contribution to the formation of the unique flavor of liquor. Therefore, it is of great significance to study the change rule of Bacillus in the process of liquor fermentation to guide the production of liquor. Since the traditional fermentation process such as liquor is the result of mixed ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
CPCC12Q1/6834C12Q2565/519C12Q2521/307C12Q2563/131
Inventor 杨海麟王武辛瑜夏小乐张玲刘婷
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products