Bacillus subtilis with effect of efficiently dissolving phosphorus and application of bacillus subtilis
A Bacillus subtilis, phosphorus solution technology, applied in bacteria, microorganism-based methods, microorganisms, etc., can solve problems such as soil compaction, grassland degradation, and soil water retention.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0015] Example 1 Microorganisms from the isolation of soil samples
[0016] From the chrysanthemum rhizosphere soil collected near Hengshui Lake, Hebei, 10g of soil was weighed and mixed with 90mL sterile water, and then 1mL samples were taken from it and diluted with 9mL sterile water, which was carried out 6 times and diluted to 10 -6 、10 -7 、10 -8 3 gradients, pipette 100 microliters of the bacterial suspension of the last three gradients, and spread on Montina inorganic phosphorus medium (glucose 10 g, (NH 4 ) 2 SO4 0.5 g, NaCl 0.3 g, KCl 0.3 g, FeSO47H2O 0.03 g, MnSO44H2O 0.03 g, MgSO47H2O 0.3 g, phosphate rock powder 10 g, yeast extract 0.4 g, agar 15 g, distilled water 1000 ml, pH 7.0~7.5) on the plate , with the last dilution as a control, cultured at 28°C, and observed every 24h. Select a strain that has no colonies in the control but grows colonies in the previous dilution, jumps a single colony according to the characteristics of the colony shape, color, etc....
Embodiment 2
[0017] Example 2 Phosphorus Screening of strains
[0018] In a sterile environment, all strains were inoculated on Montina medium and cultured at 30°C for 7 days. Observe the growth of the colonies in the plate, and screen out highly efficient phosphorus-solubilizing bacteria according to the size of the phosphorus-dissolving circle.
Embodiment 3
[0019] Example 3 Sequence Determination and Analysis of 16S rDNA of Bacterial Strains and Identification of Physiological and Biochemical Tests
[0020] Bacillus subtilis DNA was extracted using the conventional phenol method, and the 16S rDNA sequence was amplified with bacterial universal primers. The primer sequences were 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT). The PCR reaction system (50 μL) was: 5 μL of 10X PCR buffer, 4 μL of dNTP, 1 μL of each primer, 2.5 μL of DNA template, 0.25 μL of Takara Taq enzyme, and 36 μL of ultrapure water. The PCR amplification program was 94 °C for 3 min; 94 °C for 1 min, 52 °C for 1 min, 72 °C for 1.5 min, 30 cycles; 72 °C for 10 min. The amplified products were sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing.
[0021] The measured 16S rDNA sequence was input into GenBank, and BLAST software was used for homology search. The 16S rDNA sequences of different strains were selected and compared with the kn...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More