Unlock instant, AI-driven research and patent intelligence for your innovation.

Bacillus subtilis with effect of efficiently dissolving phosphorus and application of bacillus subtilis

A Bacillus subtilis, phosphorus solution technology, applied in bacteria, microorganism-based methods, microorganisms, etc., can solve problems such as soil compaction, grassland degradation, and soil water retention.

Inactive Publication Date: 2014-05-07
HEBEI AGRICULTURAL UNIV.
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, 74% of the cultivated land in my country is deficient in phosphorus, and more than 95% of the phosphorus in the soil is in an invalid form, which is difficult for plants to directly absorb and utilize. In addition, the extensive use of chemical fertilizers has obviously caused soil compaction, soil water retention, grassland degradation, and serious desertification. Adverse consequences

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0015] Example 1 Microorganisms from the isolation of soil samples

[0016] From the chrysanthemum rhizosphere soil collected near Hengshui Lake, Hebei, 10g of soil was weighed and mixed with 90mL sterile water, and then 1mL samples were taken from it and diluted with 9mL sterile water, which was carried out 6 times and diluted to 10 -6 、10 -7 、10 -8 3 gradients, pipette 100 microliters of the bacterial suspension of the last three gradients, and spread on Montina inorganic phosphorus medium (glucose 10 g, (NH 4 ) 2 SO4 0.5 g, NaCl 0.3 g, KCl 0.3 g, FeSO47H2O 0.03 g, MnSO44H2O 0.03 g, MgSO47H2O 0.3 g, phosphate rock powder 10 g, yeast extract 0.4 g, agar 15 g, distilled water 1000 ml, pH 7.0~7.5) on the plate , with the last dilution as a control, cultured at 28°C, and observed every 24h. Select a strain that has no colonies in the control but grows colonies in the previous dilution, jumps a single colony according to the characteristics of the colony shape, color, etc....

Embodiment 2

[0017] Example 2 Phosphorus Screening of strains

[0018] In a sterile environment, all strains were inoculated on Montina medium and cultured at 30°C for 7 days. Observe the growth of the colonies in the plate, and screen out highly efficient phosphorus-solubilizing bacteria according to the size of the phosphorus-dissolving circle.

Embodiment 3

[0019] Example 3 Sequence Determination and Analysis of 16S rDNA of Bacterial Strains and Identification of Physiological and Biochemical Tests

[0020] Bacillus subtilis DNA was extracted using the conventional phenol method, and the 16S rDNA sequence was amplified with bacterial universal primers. The primer sequences were 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT). The PCR reaction system (50 μL) was: 5 μL of 10X PCR buffer, 4 μL of dNTP, 1 μL of each primer, 2.5 μL of DNA template, 0.25 μL of Takara Taq enzyme, and 36 μL of ultrapure water. The PCR amplification program was 94 °C for 3 min; 94 °C for 1 min, 52 °C for 1 min, 72 °C for 1.5 min, 30 cycles; 72 °C for 10 min. The amplified products were sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing.

[0021] The measured 16S rDNA sequence was input into GenBank, and BLAST software was used for homology search. The 16S rDNA sequences of different strains were selected and compared with the kn...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a bacillus subtilis with the effect of efficiently dissolving phosphorus. The bacillus subtilis is preserved in the China General Microbiological Culture Collection Center and has the preservation NO. of CGMCCNo. 8241. The bacillus subtilis has the relatively high effect of dissolving the phosphorus, cannot pollute environment, and is ecological and safe. The efficient bacillus subtilis can be used independently, or used together with other organic and inorganic nutritional ingredients required by plants to be prepared into biological compound fertilizer, and which has the effects of increasing yield and improving quality.

Description

technical field [0001] The invention relates to the field of microbes and biological fertilizers, in particular to bacillus subtilis, and in particular, the invention relates to a bacillus subtilis with high-efficiency phosphorus-dissolving effect and an application thereof. Background technique [0002] Phosphorus fertilizer can promote plant flower bud differentiation, early flowering and fruiting, promote seedling root growth and improve fruit quality. Phosphorus application can promote the normal progress of various metabolisms, good plant growth and development, and at the same time improve the cold resistance and drought resistance of plants. Since phosphorus is related to the metabolism of carbohydrates, proteins and fats and the mutual transformation of the three, phosphorus fertilizers are often required regardless of the cultivation of food crops, bean crops and oil crops. When phosphorus is deficient, protein synthesis is blocked, new cytoplasm and nucleus are le...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C12R1/125
Inventor 时翠平霍静倩赵斌齐萌张金林董金皋
Owner HEBEI AGRICULTURAL UNIV.
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More