Perinereisaibuhitensis beta-1, 4-endoglucanase gene sequence and perinereisaibuhitensis beta-1, 4-endoglucanase gene clone method

A technology of endoglucanase and P. didentate nereis, which is applied in the fields of genetic engineering, plant genetic improvement, botany equipment and methods, etc., and can solve problems that are not completely clear

Inactive Publication Date: 2014-06-25
SHENYANG INST OF APPLIED ECOLOGY - CHINESE ACAD OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The hydrolysis mechanism of cellulase is still not completely clear, but it is generally believed that: first, exo-cellulase cracks the long molecular chain of cellulose with crystal structure, depolymerizes the aggregate structure, and frees the terminal part of the long chain molecule, forming cellulose The action of hydrolase improves the accessibility and reactivity, so that the cellulose is easy to hydrate; then the endoenzyme acts on the cellulose activated by the exoenzyme, decomposes the β-1,4-glycosidic bond in the molecule, and produces cellulosic Short-chain oligosaccharides such as sugars and trisaccharides; finally, β-glucosidase hydrolyzes oligosaccharides such as cellobiose into glucose molecules

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Perinereisaibuhitensis beta-1, 4-endoglucanase gene sequence and perinereisaibuhitensis beta-1, 4-endoglucanase gene clone method
  • Perinereisaibuhitensis beta-1, 4-endoglucanase gene sequence and perinereisaibuhitensis beta-1, 4-endoglucanase gene clone method
  • Perinereisaibuhitensis beta-1, 4-endoglucanase gene sequence and perinereisaibuhitensis beta-1, 4-endoglucanase gene clone method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] The β-1,4-endoglucanase gene of P. didentate worm is shown in SEQ ID NO.1:

[0017] gaaaacagtt tcaccagaag gaattcagtc atggcttcct ttgcttacat ccttgctgcg

[0018] gtggcacttc tggcttcctg ccatgcacag tacaactacc gcaacgcgct tcagaaatcc

[0019] atcctattct acgctgccca aagatctggc cgactcccta gtaacaaccc aatagactgg

[0020] aggggagact ctgctcttgg tgatcaggga aacaatggcc aggacctaac tggaggatgg

[0021] tatgatgctg gagaccatgt aaaattcggt cttcccatgg cttggtctgc cacgacactc

[0022] atctggggta tgatcgattt tgcaaacgga tatggagcag acaggaataa tgcaatgcag

[0023] agtgttcgat gggccctgga ctacttcatg aagtgccatg tgtcagacaa tgaattctat

[0024] ggacaggttg gagatggaca cgctgaccat gcctactggg gtaggccaga ggagatgaat

[0025] atgaacagac ctgcttggag catcagaccc ggagcacctg gatctgacct cgcaggagaa

[0026] actgctgctg ccctggctgc gggatccatt ctcttcagtg attctgatgc aaactatgct

[0027] aaccagctgc gaaaccatgc tcgtactctc tacgactttg cctacaataa ccgaggagta

[0028] tatcatgact ccatccctaa tgctgctgac ttttaccgat ctggcggata ccaagatgaa ...

Embodiment 2

[0051] Example 2 Cloning method of C. bidenta β-1,4-endoglucanase gene

[0052] The method for cloning the above-mentioned β-1,4-endoglucanase gene from the clam worm is as follows:

[0053] (1) Total RNA was extracted from live and healthy adult tissues of P. didentatus;

[0054] (2) Use TaKaRa5'-Full Race kit and downstream outer specific primer EG-Outer-R and downstream inner specific primer EG-Inner-R for 5'-RACE reaction, and clone to obtain β-1,4-endo Glucanase gene 5' end sequence;

[0055] (3) Perform RT-PCR reaction with the reverse primer EG-F, and clone the 3' end sequence of the β-1,4-endoglucanase gene;

[0056] (4) The nucleotide sequence of the β-1,4-endoglucanase gene was finally obtained by splicing and correcting the sequence fragments.

[0057] Wherein said primers include:

[0058] Downstream outer specific primer EG-Outer-R: 5'-TTCCTGTCTGCTCCATATCC-3'

[0059] Downstream inner specific primer EG-Inner-R: 5'-GTTAGGTCCTGGCCATTGTT-3'

[0060] Reverse pr...

Embodiment 3

[0134] Example 3 Expression of Neris bidentata β-1,4-endoglucanase under different concentrations of Cu stress

[0135] With CuSO containing 1mg / L or 5mg / L respectively 4 The artificial seawater solution (salinity is 16‰) treated the Nereis didentate shown in the above sequence table SEQ ID NO.1 for 3 days, and at the same time extracted the sutra containing 1mg / L or 5mg / L CuSO 4 Nereis worms in different treatment groups of artificial seawater solution and control group (without CuSO 4 Treatment) RNA of Nereis worm, see the above examples for the extraction method of total RNA, use fluorescent quantitative PCR instrument to do expression difference analysis, quantitative PCR primers are S1 and S2

[0136] S1: 5'AATGATGACAGGCAGGATTACG 3'

[0137] S2: 5'TCCCAGCACCGATTTAGAGTT 3'

[0138] The results showed that the expression of β-1,4-endoglucanase was significantly increased after Cu stress treatment, which was 115 and 824 times that of the control, respectively (see figure...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of gene clone in molecular biology, and in particular relates to a perinereisaibuhitensis beta-1, 4-endoglucanase (EG) gene sequence and a perinereisaibuhitensis beta-1, 4-endoglucanase (EG) gene clone method. The perinereisaibuhitensis beta-1, 4-endoglucanase (EG) gene sequence is shown as a nucleotide sequence shown in SEQ ID NO.1. According to the invention, a beta-1, 4-endoglucanase (EG) gene is cloned from perinereisaibuhitensis, the sequence cDNA (complementary DNA) overall length is 1481bp, an open reading frame is located at site-31 to site-1365 nucleotides, and 444 amino acid residues are encoded. Successful clone and sequencing of the perinereisaibuhitensis beta-1, 4-endoglucanase (EG) gene lay the foundation for further analysis of the biological resistance ability under the influence of cellulose and screening and application of other functions of the cellulase; and a methodological guide is provided for using expression situations of the beta-1, 4-endoglucanase (EG) gene on pollutants in different concentrations as an early warning tool for pollution.

Description

technical field [0001] The invention belongs to the field of gene cloning in molecular biology, and specifically relates to a gene sequence of P. didentate nereis β-1,4-endoglucanase (EG) and a cloning method thereof. Background technique [0002] Cellulase is a general term for a group of enzymes that can hydrolyze cellulose into glucose. Cellulase is not produced in higher animals, but cellulase can be produced in a few lower invertebrates such as snails, ants, and earthworms; cellulase produced by microorganisms in the rumen and cecum of herbivores degrades cellulose into herbivore Animals provide energy. The hydrolysis of cellulose compound enzyme is an effective way to completely decompose cellulose. Cellulase is a multi-component complex enzyme, generally including endoglucanase (EC3.2.1.4, also known as C x enzyme, CMC enzyme), exoglucanase (EC3.2.1.91, also known as C 1 enzyme, microcrystalline cellulase) and β-glucosidase (EC3.2.21, referred to as βG or cellobia...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/56C12N9/42C12N15/10
Inventor张倩茹牟文燕魏树和周启星
OwnerSHENYANG INST OF APPLIED ECOLOGY - CHINESE ACAD OF SCI