Check patentability & draft patents in minutes with Patsnap Eureka AI!

Anti-HER2 polyclonal antibody as well as preparation method and application thereof

A polyclonal antibody and protein technology, applied in the field of bioengineering, can solve the problems of clinical prognosis, recurrence or metastasis of tumor recurrence, and achieve high specificity and high sensitivity.

Inactive Publication Date: 2014-07-09
杭州雅盛生物科技有限公司
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

After breast cancer surgery, systemic chemotherapy, radiotherapy, or endocrine therapy can relieve clinical symptoms, but the amplification of HER2 gene can lead to tumor recurrence and poor clinical prognosis, and recurrence or metastasis can occur

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-HER2 polyclonal antibody as well as preparation method and application thereof
  • Anti-HER2 polyclonal antibody as well as preparation method and application thereof
  • Anti-HER2 polyclonal antibody as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Preparation of polyclonal antibody IgY

[0036] 1.1 Preparation of immunogen

[0037] 1.1.1 According to the HER2 gene sequence, self-designed primers:

[0038] Upstream primer: CGAGCTCATGGAGCTGGCGGCCTTGTGCCGCT, downstream primer: CCGCTCGAGTTACGTCAGAGGGCTGGCTCTCTGCT, using HER2 DNA as a template, amplify the target gene by PCR, construct a recombinant plasmid, transform Escherichia coli, and induce the expression of HER2 protein expressed in inclusion bodies. and chromatographic purification to obtain high-purity antigenic protein HER2.

[0039] 1.1.2 Freund's complete adjuvant (FCA) was used for the first immunization, and Freund's incomplete adjuvant (FIA) was used for booster immunization.

[0040] 1.1.3 Freund's complete adjuvant (FCA) preparation

[0041] 1.1.3.1 The volume ratio of light liquid paraffin and Span-80 is 85:15.

[0042] For example, to prepare 200mL FCA, take light liquid paraffin 170mL×0.847 (relative density)=144g; Span-80: 30mL×0.969 (relative...

Embodiment 2

[0092] Polyclonal antibody IgY titer detection

[0093] 2.1 Detection of IgY titer by ELISA method

[0094] ELISA indirect method was used to detect the titer of IgY, and the procedure was as follows:

[0095] 1) Dilute the HER2 antigen to a concentration of 5 μg / mL with 50 mM carbonate buffer, add to a microtiter plate, 120 μL per well, seal, and coat overnight at 4°C;

[0096] 2) Take out the next day, shake off the coating solution, buckle dry on absorbent paper, add blocking solution, 250 μL per well, the blocking solution is 1% BSA dissolved in PBST, seal, and block overnight at 4 °C;

[0097] 3) Take it out the next day, wash the plate 3 times, dry it on absorbent paper, and dry at 37°C for 30 minutes;

[0098] 4) The polyclonal egg yolk antibody IgY freeze-dried powder obtained in Example 1 was dissolved in PBST at 1 mg / mL, and then 2-fold serial dilution was performed with PBST as a starting point, and the sample to be tested diluted according to this was added, and ...

Embodiment 3

[0108] Application of Immunohistochemical Method in Detecting HER2 Antigen

[0109] 3.1 Preparation of HER2 immunohistochemical diagnostic kit method

[0110]3.1.1 Preparation of IgY antibody: The purified polyclonal egg yolk antibody IgY (see Example 1 for the purification method) was dissolved in sterilized PBS to a concentration of 2 mg / mL, added sterile glycerol at a ratio of 1:1, and stored in -80℃ low temperature refrigerator.

[0111] 3.1.2 Establishment of immunohistochemical detection method for HER2: through the optimization of immunohistochemical test conditions, a qualitative detection method for HER2 was established. The specific steps are as follows:

[0112] 1) Slice, the thickness of each slice is 4 μm, bake at 60°C for 2-3 hours or overnight;

[0113] 2) Xylene dewaxing 3 times, each 10min;

[0114] 3) Gradient alcohol dexylene to hydration (100%→90%→75%→50%), each for 5 minutes;

[0115] 4) Washing: wash with PBS 3 times, 5 min each;

[0116] 5) Enzyme b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an anti-HER2 polyclonal antibody as well as a preparation method and application thereof, wherein the anti-HER2 polyclonal antibody is applied in preparation of an immune detection tool for detecting HER2 protein. The anti-HER2 polyclonal antibody is applied in preparation of a kit used for diagnosing malignancy generated by excessive HER2 expression. The anti-HER2 polyclonal antibody provided by the invention is used for providing a high-specificity, high-sensitivity and high-quality antibody for HER2 protein antigen detection.

Description

technical field [0001] The invention relates to the field of bioengineering, in particular to an anti-HER2 polyclonal antibody and its preparation and application. Background technique [0002] HER2, human epidermal growth factor receptor 2 (human epidermal growth factor receptor 2, HER2), also known as ErbB2 / neu, is a member of the epidermal growth factor receptor (epidermal growth factor receptor, EGFR) family. In 1987, Slamon et al. reported the expression of HER2 in breast cancer cells for the first time in a study of 189 breast cancers, pointing out that the HER2 gene plays an important role in the biological behavior and pathogenesis of breast cancer. HER2 gene, originally a transformation gene found in rat nerve / gliofibroma induced by ethylnitrosourea, is located on human chromosome 17q21 and encodes a transmembrane protein with a molecular weight of 185KD, also known as p185, HER2 The protein consists of 1255 amino acids, including three parts: extracellular domain ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/28C07K16/02G01N33/68G01N33/574
Inventor 毕爱国刘诚周冬冬
Owner 杭州雅盛生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More