Bleomycin resistance reporter gene mutant, and preparation method and application thereof

A bleomycin and reporter gene technology, applied in the field of molecular biology, can solve the problems of whole gene range detection, low efficiency, inability to locate off-target effects, etc.

Inactive Publication Date: 2014-08-13
SUZHOU UNIV
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The off-target effect detection methods used in the prior art, such as the mismatched double-strand detection method, not only have low sensitivity and low efficiency, but also cannot locate the off-target effect and detect the whole gene range

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bleomycin resistance reporter gene mutant, and preparation method and application thereof
  • Bleomycin resistance reporter gene mutant, and preparation method and application thereof
  • Bleomycin resistance reporter gene mutant, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Construction of Bleomycin Resistance Reporter Gene Mutants with PPICZαA and pEGFP-N3 Plasmids

[0041] (1). Prepare the reporter plasmid pZGA that can be used to explore the concentration of bleomycin used in specific experiments.

[0042]In order to achieve the above object, the technical scheme of the present invention is: insert the bleomycin resistance gene coding sequence before the GFP reading frame of the pEGFP-N3 plasmid, and remove its stop codon at the same time to fuse the bleomycin resistance gene reading frame and GFP reading frames. Specifically include the following steps:

[0043] 1. Using the PPICZαA plasmid as a template,

[0044] Primer 1: CGATCCGCTAGCATGGCCAAGTTGACCAGTGCCGTTC (SeqNo.1)

[0045] Primer 2: TGGCTGGATCCGTCCTGCTCCTCGGCCACGAAG (Seq No.2)

[0046] A PCR amplification kit (Thermoscientific Company) was used to amplify the sequence Seq No. 16 corresponding to the target fragment of the bleomycin resistance gene using the above p...

Embodiment 2

[0070] Embodiment 2 constructs bleomycin resistance reporter gene mutant with PMD-19 and pPICαA plasmid

[0071] (1) Construction of bleomycin and ampicillin double resistance plasmid pZAA

[0072] 1. Design and synthesize specific primers for overlap extension PCR to obtain the bleomycin resistance gene 1.1 Using the PMD-19 plasmid as a template,

[0073] Primer 4: 5'-CCTCTGACTTGAGCGTCGATTTTTGTG-3'; (Seq No.4)

[0074] Primer 5: 5'-GTCAACTTGGCCATAGCTGTTTCCTGTGTGAAATTGTTATCCG-3'(Seq No.5)

[0075] Perform PCR amplification to obtain the target product fragment 1; wherein, each 25 μL PCR reaction system includes: 2.5 μL of 10×Pfu Buffer with MgSO4, 0.3 μL of Pfu Polymerase (2.5U / μL), 0.5 μL of dNTP Mix (10mM each ), the two specific primers were 5μM and 5μM respectively, the template was 40ng, and the rest was water. The PCR reaction conditions were: pre-denaturation at 95°C for 5min; denaturation at 95°C for 20S, annealing at 58°C for 20S, extension at 72°C for 30S, a total...

Embodiment 3

[0115] In Example 3, 32bp, 33bp, and 21bp heterologous nucleic acid sequences containing stop codons were respectively inserted into PZAB to verify the feasibility and sensitivity of the bleomycin reporter gene.

[0116] 1. Entrust a primer synthesis company to synthesize the following oligos:

[0117] 32+: CTAGAGATATCGTCGACCTGCAGAAGCTTCCGCGGTT, (Seq No. 10)

[0118] 32-:CGGAAGCTTCTGCAGGTCGACGATATCTCTAGCATAG,, (Seq No.11)

[0119] 33+:CCTAGAGATATCGTCGACCTGCAGAAGCTTCCGCGGTT, (Seq No.12)

[0120] 33-:CGGAAGCTTCTGCAGGTCGACGATATCTCTAGGCATAG, (Seq No. 13)

[0121] 21+: AAGCTGGATATCGTATAGCTTCGGTT, (Seq No. 14)

[0122] 21-: AAGCTATACGATATCCAGCTTCATAG, (Seq No. 15)

[0123] 1. Insert each length into the nucleic acid fragment oligo to construct the annealing system respectively. The Annealing system is:

[0124] oligonucleotide+100nmol / ml, oligonucleotide-100nmol / ml, 10× annealing buffer 1×, DEPC-water appropriate amount.

[0125] 10×Annealing buffer composition: 10mM Tris-HCL...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses bleomycin resistance reporter gene mutant, and a preparation method and application thereof. A heterogenous target sequence nucleotide fragment with a certain length is inserted between an initiation codon ATG and a subsequent first amino acid codon GCC of bleomycin gene, and the heterogenous nucleotide fragment with a certain length is a heterogenous target sequence nucleotide fragment with a certain length more than or equal to 1 bp base and less than integer multiple or non-integer multiple of 3 of 1 kb base. By performing insertion mutation on bleomycin resistance reporter gene, a double-resistance plasmid for detecting nuclease activity is constructed. By observing existing or non-existing of bacterium colonies with different resistance or survival and death of cells, evaluation on nuclease activity and off-target effect are performed. Compared with conventional detection technologies, the method has the advantages of being rapid, accurate, simple, and low in cost, and especially, the highlight is that the new method is far higher in sensitivity than that of the prior art.

Description

technical field [0001] The present invention relates to the field of molecular biology, in particular to medical diagnosis and biotechnology, and in particular to the insertion and mutation of the bleomycin resistance reporter gene to obtain both qualitative and functional proteins that can be used in both prokaryotic and eukaryotic systems. Quantitative nuclease activity detection technology cell screening technology. Background technique [0002] Zinc finger nuclease, meganuclease, antifactor nuclease (TAL nuclease) and CRISPR-Cas nuclease are all new enzymes that can be designed for genetic engineering, and have It plays a very important role and can be used for genetic modification of species, preparation of animal models, preparation of cell lines, as well as gene therapy research and clinical application. [0003] Among the above-mentioned genetically engineered enzymes, zinc finger nucleases have a long history, and their applications are limited due to complex opera...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/70C12N15/85C12N1/21C12N5/10C12Q1/68C12Q1/34C12Q1/04C12N15/10
Inventor李凯徐惠芬张安迪张佳
OwnerSUZHOU UNIV