Unlock instant, AI-driven research and patent intelligence for your innovation.

Backbone plasmid carrier for genetic engineering and application thereof

A plasmid carrier and genetic engineering technology, applied in the field of plant genetic engineering, can solve the problems of limited combination efficiency, single applicability, and lack of coding methods

Active Publication Date: 2014-08-13
RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
View PDF1 Cites 25 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current limited reports mainly focus on mechanism research, and rice genetic engineering vectors have not yet been optimized, mainly due to the limited combination efficiency of sgRNA and Cas9 used in existing vectors (Shan et al. The conversion method for CRISPR / Cas9 targeting efficiency is only 4.0% to 9.4%); the operation is cumbersome, and it is necessary to construct two vectors of sgRNA and Cas9 for co-transformation (Xie et al., Molecular Plant in 2013) or two clones to convert sgRNA and Cas9 The expression cassette is integrated into a plasmid (Miao et al., 2013, Cell Research); the applicability is single, and most of the existing plant CRISPR / Cas9 system vectors are stable expression vectors with too large molecular weight for transient transformation (Miao et al., 2013 , Cell Research), or the lack of T-DNA borders that cannot be used for transient vectors for Agrobacterium-mediated transformation; and the lack of suitable rice endogenous promoters and coding methods suitable for rice expression, etc. (Mao et al., 2013 Molecular Plant), greatly limiting the advantages of CRISPR / Cas9-mediated gene targeting technology in rice variety improvement

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Backbone plasmid carrier for genetic engineering and application thereof
  • Backbone plasmid carrier for genetic engineering and application thereof
  • Backbone plasmid carrier for genetic engineering and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0041] Design of backbone plasmid vectors

[0042] Specifically, the present invention designs such a backbone plasmid vector, which includes a guide RNA expression cassette and a Cas9 nuclease expression cassette, and the guide RNA expression cassette includes: rice U6 promoter, spectinomycin resistance gene, artificially synthesized sgRNA backbone sequence and and Poly-T terminator. The Cas9 nuclease expression cassette includes: the maize ZmUBI promoter, the Cas9 coding sequence and the 35s terminator modified by rice preferred codons (the modification method is the prior art). The above sequence is a unique part of the backbone plasmid vector, which may also include some general structures of conventional vectors, which will not be repeated here. An implementation of the backbone plasmid vector designed in the present invention is shown in Seq ID NO.1. The vector can be constructed in a conventional manner in the prior art.

[0043] In order to facilitate the constructi...

Embodiment 2

[0054] Example 2. Rice BEL gene targeting mediated by transient transformation of protoplasts.

[0055] 2.1, using the PEG method to transform the pHUN4c16-BEL plasmid into rice Nipponbare protoplasts, the specific process of rice protoplast transformation refers to the literature Zhang et al. A highly efficient rice green tissue protoplast system for transient gene expression and studying light / chloroplast-related processes.Plant Experimental method disclosed in Method (2011).

[0056] 2.2. Genomic DNA was extracted 48 hours after the transformation of rice protoplasts using a small plant genome extraction kit (Tiangen Biochemical Company). Using the DNA as a template, use Phusion high-fidelity DNA polymerase (NEB company) to PCR amplify the sequence containing the target region, wherein the primers used for PCR amplification are:

[0057] Bel KO1 genome check FP: CAGAGTCACAGAAACACATCAC

[0058] Bel KO1genome check RP:CTTCCTCCTGACGCCGAACACG

[0059] 2.3. After the obtained...

Embodiment 3

[0063] Example 3. Targeting of rice BEL gene mediated by Agrobacterium stable transgene.

[0064] 3.1. The pHUN4c16-BEL recombinant vector was transformed into Agrobacterium tumefaciens EHA105 (preserved by the rice group of the Supervision, Inspection and Testing Center for Components of Genetically Modified Biological Products, Ministry of Agriculture, Anhui Academy of Agricultural Sciences) by freeze-thaw method, and positive clones were obtained.

[0065] 3.2. After the chaff is removed from the mature seeds, soak the seeds with 70% alcohol for 1 min, and pour off the alcohol. Soak the seeds for 40min (150r / min) with a solution of 50% sodium hypochlorite (the concentration of available chlorine in the stock solution is greater than 4%) containing 1 drop of Tween20. Pour off the sodium hypochlorite, wash with sterile water 5 times until the solution is clear, without the smell of sodium hypochlorite. Soak the seeds in sterile water overnight. The embryos were peeled off a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a backbone plasmid carrier for genetic engineering. In the backbone plasmid carrier, a guide RNA (Ribonucleic Acid) expression frame and a Cas9 nuclease expression frame are positioned in one same double-element carrier; the guide RNA expression frame sequentially consists of a rice U6 promoter, a spectinomycin resistance gene, an artificially synthesized sgRNA backbone sequence and a Poly-T terminator; the Cas9 nuclease expression frame sequentially consists of a ZmUBI promoter, a rice preference codon modified Cas9 coded sequence and a 35s terminator. The invention further discloses a recombinant carrier which is established by using the plasmid carrier and contains a target sequence, and an application of the recombinant carrier in rice gene targeting.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to a genetic engineering carrier for plant gene targeting and its application in rice genetic modification. Background technique [0002] Rice is one of the most important crops in the world. Rice production is closely related to national economic life, and continuous cultivation of varieties with better agronomic shapes is crucial for rice production. Compared with traditional breeding methods, the gene targeting technology developed in the past ten years provides a convenient and efficient means for improving key shapes such as rice yield, quality and resistance. Traditional gene targeting methods include homologous recombination technology, zinc finger nuclease technology (ZFN) and transcription factor activator-like technology (TALEN), among which homologous recombination technology has a very low targeting efficiency in plants, while ZFN and TALEN technolog...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/84C12N15/66C12N1/21A01H5/00C12R1/01
Inventor 秦瑞英杨剑波李莉魏鹏程李浩杨亚春倪大虎倪金龙宋丰顺陆徐忠马卉
Owner RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More