Backbone plasmid carrier for genetic engineering and application thereof
A plasmid carrier and genetic engineering technology, applied in the field of plant genetic engineering, can solve the problems of limited combination efficiency, single applicability, and lack of coding methods
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0041] Design of backbone plasmid vectors
[0042] Specifically, the present invention designs such a backbone plasmid vector, which includes a guide RNA expression cassette and a Cas9 nuclease expression cassette, and the guide RNA expression cassette includes: rice U6 promoter, spectinomycin resistance gene, artificially synthesized sgRNA backbone sequence and and Poly-T terminator. The Cas9 nuclease expression cassette includes: the maize ZmUBI promoter, the Cas9 coding sequence and the 35s terminator modified by rice preferred codons (the modification method is the prior art). The above sequence is a unique part of the backbone plasmid vector, which may also include some general structures of conventional vectors, which will not be repeated here. An implementation of the backbone plasmid vector designed in the present invention is shown in Seq ID NO.1. The vector can be constructed in a conventional manner in the prior art.
[0043] In order to facilitate the constructi...
Embodiment 2
[0054] Example 2. Rice BEL gene targeting mediated by transient transformation of protoplasts.
[0055] 2.1, using the PEG method to transform the pHUN4c16-BEL plasmid into rice Nipponbare protoplasts, the specific process of rice protoplast transformation refers to the literature Zhang et al. A highly efficient rice green tissue protoplast system for transient gene expression and studying light / chloroplast-related processes.Plant Experimental method disclosed in Method (2011).
[0056] 2.2. Genomic DNA was extracted 48 hours after the transformation of rice protoplasts using a small plant genome extraction kit (Tiangen Biochemical Company). Using the DNA as a template, use Phusion high-fidelity DNA polymerase (NEB company) to PCR amplify the sequence containing the target region, wherein the primers used for PCR amplification are:
[0057] Bel KO1 genome check FP: CAGAGTCACAGAAACACATCAC
[0058] Bel KO1genome check RP:CTTCCTCCTGACGCCGAACACG
[0059] 2.3. After the obtained...
Embodiment 3
[0063] Example 3. Targeting of rice BEL gene mediated by Agrobacterium stable transgene.
[0064] 3.1. The pHUN4c16-BEL recombinant vector was transformed into Agrobacterium tumefaciens EHA105 (preserved by the rice group of the Supervision, Inspection and Testing Center for Components of Genetically Modified Biological Products, Ministry of Agriculture, Anhui Academy of Agricultural Sciences) by freeze-thaw method, and positive clones were obtained.
[0065] 3.2. After the chaff is removed from the mature seeds, soak the seeds with 70% alcohol for 1 min, and pour off the alcohol. Soak the seeds for 40min (150r / min) with a solution of 50% sodium hypochlorite (the concentration of available chlorine in the stock solution is greater than 4%) containing 1 drop of Tween20. Pour off the sodium hypochlorite, wash with sterile water 5 times until the solution is clear, without the smell of sodium hypochlorite. Soak the seeds in sterile water overnight. The embryos were peeled off a...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 