Unlock instant, AI-driven research and patent intelligence for your innovation.

Photobacterium damsela rapid detection primer, kit and application

A technology for detecting kits and photobacteria, which is applied in the direction of microorganisms, methods based on microorganisms, biochemical equipment and methods, etc., can solve the problems of complicated operation, high cost, and time-consuming bacteria isolation and identification, and achieve operational specifications and are less prone to errors , to achieve programmatic and standardized effects

Inactive Publication Date: 2014-08-13
天津市水产技术推广站
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, for the detection of fish Photobacterium mermaid, traditional bacterial isolation and identification are mainly used. Serological reaction and PCR detection technology have not yet been established. Bacterial isolation and identification is time-consuming and costly. Most of them are based on the premise of killing aquatic animals. The operation is complicated and requires With professional equipment and technical personnel, there is an urgent need for a rapid, accurate, and easy-to-operate detection technology and products for Photobacterium mermaid that can be applied to aquaculture production.
At present, there is no report on the LAMP detection technology of Photobacterium mermaidus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Photobacterium damsela rapid detection primer, kit and application
  • Photobacterium damsela rapid detection primer, kit and application
  • Photobacterium damsela rapid detection primer, kit and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] A rapid detection primer for Photobacterium mermaidus, which is composed of an outer primer and an inner primer, and the outer primer is composed of an outer primer upstream primer shown in SEQ ID NO.1 and an outer primer downstream primer shown in SEQ ID NO.2; The internal primer is composed of the upstream primer of the internal primer shown in SEQ ID NO.3 and the downstream primer of the internal primer shown in SEQ ID NO.4.

Embodiment 2

[0040] A rapid detection kit for Photobacterium mermaid, (taking the packaging of 8 samples as an example) includes:

[0041] (1) 8 sampling tubes filled with sample pretreatment solution, 100 μl sample pretreatment solution is arranged in each tube, the composition of sample pretreatment solution is 20mmol / L Tris-HCl of pH=8.0, 2mmol / L EDTA, volume concentration is 1.2% Triton X-100, the solvent is distilled water;

[0042](2) 10 washing tubes, each containing 100μl DEPC water

[0043] (3) 10 reaction tubes, each tube containing 24 μl LAMP reaction solution, which consists of: 2.5 μl 10× reaction buffer, 3 μl dNTP with a concentration of 2.5 mmol / L, 1 μl Bst DNA polymerase with a concentration of 8 U / μl; 1 μl Concentration is 5 μ mol / L by the outer primer upstream primer shown in SEQ ID NO.1, 1 μ l concentration is 5 μ mol / L by the outer primer downstream primer shown in SEQ ID NO.2, 1 μ l concentration is 40 μ mol / L by SEQ ID NO.2 The upstream primer of the internal primer...

Embodiment 3

[0047] Establishment of detection method of Photobacterium mermaid rapid detection kit (using the kit of Example 2)

[0048] (1) Template preparation: use the DNA extraction kit (Tiangen’s rapid DNA extraction and detection kit KG203) to extract the purely cultured Photobacterium mermaidi genomic DNA as a positive control solution, and use the purely cultured Photobacteria mermaida bacteria liquid as a detection Samples to test the feasibility of the established detection method.

[0049] (2) Design and synthesis of primers

[0050] The BLAST software was used to analyze the gene sequence of Photobacterium damselae, and the nucleic acid sequence of the Photobacterium damselae subsp.piscicida IGS2 (AJ535849.1) gene was screened out. According to the primer design principle of LAMP technology, LAMP primers were designed and synthesized for this fragment. The primers used as follows:

[0051] SEQ ID NO.1: 5'ACTCTTTTCTTAGGATAAGAAAGGT3'

[0052] SEQ ID NO.2: 5'ACCACTTTTTAATAACTT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a photobacterium damsela rapid detection primer, a kit and an application. The primer consists of an outer primer and an inner primer, wherein the outer primer consists of an outer primer upstream primer shown by SEQ ID NO.1 and an outer primer downstream primer shown by SEQ ID NO. 2; the inner primer consists of an inner primer upstream primer shown by SEQ ID NO.3 and an inner primer downstream primer shown by SEQ ID NO.4. The problems that the detection of photobacterium damsela is long in cycle and high in detection cost, can not be applied to on-site detection, and the like in the prior art can be solved by adopting the photobacterium damsela rapid detection primer; the primer disclosed by the invention is rapid and ordered in detection, realizes the routinization and standardization of the detection process, is standard in operation, and is hard to cause errors; an amplification primer has very good specificity and accuracy; by adopting a method of embedding dyes, a reaction pipe does not need to be opened after completing reaction, and results can be directly observed by naked eyes after taking out the reaction pipe, thus preventing amplified products from polluting follow-up samples to be detected, and improving the application reliability of the kit.

Description

technical field [0001] The present invention relates to a rapid detection kit and detection method for photobacterium mermaid, in particular to a rapid detection kit and detection method for aquaculture fish pathogenic bacteria using loop-mediated isothermal amplification technology, which belongs to aquatic pathogenic bacteria Rapid detection field. Background technique [0002] Photobacterium damselae subsp.piscicida is a hemolytic Gram-negative short bacterium with capsules, which was once called Pasteurella piscicida, mermaid arc Vibrio damsela, the host of parasitic infection is not specific, and it is highly pathogenic to a variety of farmed fish, and can cause diseases such as American wolf bass, channel catfish, Japanese five yellowtail, cobia, yellowtail amberjack, and gilthead sea bream , in China, the bacteria has been isolated from large yellow croaker, semi-smooth tongue sole, oval pomfret, eastern star spot, gentian grouper, etc. It is one of the important pat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/01
CPCC12Q1/6844C12Q2531/119C12Q2563/173
Inventor 徐晓丽姚学良邵蓬张勤张振奎
Owner 天津市水产技术推广站
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More