Photobacterium damsela rapid detection primer, kit and application
A technology for detecting kits and photobacteria, which is applied in the direction of microorganisms, methods based on microorganisms, biochemical equipment and methods, etc., can solve the problems of complicated operation, high cost, and time-consuming bacteria isolation and identification, and achieve operational specifications and are less prone to errors , to achieve programmatic and standardized effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] A rapid detection primer for Photobacterium mermaidus, which is composed of an outer primer and an inner primer, and the outer primer is composed of an outer primer upstream primer shown in SEQ ID NO.1 and an outer primer downstream primer shown in SEQ ID NO.2; The internal primer is composed of the upstream primer of the internal primer shown in SEQ ID NO.3 and the downstream primer of the internal primer shown in SEQ ID NO.4.
Embodiment 2
[0040] A rapid detection kit for Photobacterium mermaid, (taking the packaging of 8 samples as an example) includes:
[0041] (1) 8 sampling tubes filled with sample pretreatment solution, 100 μl sample pretreatment solution is arranged in each tube, the composition of sample pretreatment solution is 20mmol / L Tris-HCl of pH=8.0, 2mmol / L EDTA, volume concentration is 1.2% Triton X-100, the solvent is distilled water;
[0042](2) 10 washing tubes, each containing 100μl DEPC water
[0043] (3) 10 reaction tubes, each tube containing 24 μl LAMP reaction solution, which consists of: 2.5 μl 10× reaction buffer, 3 μl dNTP with a concentration of 2.5 mmol / L, 1 μl Bst DNA polymerase with a concentration of 8 U / μl; 1 μl Concentration is 5 μ mol / L by the outer primer upstream primer shown in SEQ ID NO.1, 1 μ l concentration is 5 μ mol / L by the outer primer downstream primer shown in SEQ ID NO.2, 1 μ l concentration is 40 μ mol / L by SEQ ID NO.2 The upstream primer of the internal primer...
Embodiment 3
[0047] Establishment of detection method of Photobacterium mermaid rapid detection kit (using the kit of Example 2)
[0048] (1) Template preparation: use the DNA extraction kit (Tiangen’s rapid DNA extraction and detection kit KG203) to extract the purely cultured Photobacterium mermaidi genomic DNA as a positive control solution, and use the purely cultured Photobacteria mermaida bacteria liquid as a detection Samples to test the feasibility of the established detection method.
[0049] (2) Design and synthesis of primers
[0050] The BLAST software was used to analyze the gene sequence of Photobacterium damselae, and the nucleic acid sequence of the Photobacterium damselae subsp.piscicida IGS2 (AJ535849.1) gene was screened out. According to the primer design principle of LAMP technology, LAMP primers were designed and synthesized for this fragment. The primers used as follows:
[0051] SEQ ID NO.1: 5'ACTCTTTTCTTAGGATAAGAAAGGT3'
[0052] SEQ ID NO.2: 5'ACCACTTTTTAATAACTT...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com