Artificially constructed hybrid ubiquitin conjugation structure domain polypeptide and application thereof

A technology that combines structural domains and structural domains, applied in the biological field, can solve problems such as the inability to comprehensively ubiquitinate proteomics research

Active Publication Date: 2014-10-01
ACADEMY OF MILITARY MEDICAL SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the previous reports, a single UBA domain was used. In the process of large-scale ubiquitinated protein enrichment, the binding of different ubiquitin chain modification substrates will be biased according to the characteristics of the selected ubiquitin binding domain. Unable to comprehensively and truly conduct ubiquitination proteomics research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Artificially constructed hybrid ubiquitin conjugation structure domain polypeptide and application thereof
  • Artificially constructed hybrid ubiquitin conjugation structure domain polypeptide and application thereof
  • Artificially constructed hybrid ubiquitin conjugation structure domain polypeptide and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0083] Example 1. Quantitative comparison of affinity properties between different ubiquitin-binding domains and ubiquitin.

[0084] 1. Expression and purification of ubiquitin-binding domain polypeptides

[0085] 1. Construction of recombinant expression vector

[0086] DNA fragments containing different ubiquitin-binding domains were amplified by PCR method, and cloned into pGEX-4T-2 expression vector (GE Life Sciences) containing GST-tagged protein. The cloned ubiquitin binding domain is fused with the GST tag protein to obtain the GST-ubiquitin binding domain fusion protein. In addition, a hybrid ubiquitin-binding domain was also constructed: two different ubiquitin-binding domain coding sequences were connected through a linker sequence using fusion PCR technology to form a hybrid ubiquitin-binding domain, and it was cloned into the GST-tagged protein on the pGEX-4T-2 expression vector. See Table 1 for information about the ubiquitin-binding domains involved in this ex...

Embodiment 2

[0125] Example 2. Quantitative comparison of the affinity properties of different ubiquitin-binding domains generated in tandem with ubiquitin

[0126] 1. Expression and purification of tandem ubiquitin-binding domain polypeptides

[0127] 1. Construction of recombinant expression vector

[0128] There are five types of tandem ubiquitin binding domains involved in this example: 4UQ2, 4DSK2, 4A20, 4(DSK2-A20) and 4(DSK2-UQ2). Each hybrid ubiquitin-binding domain was cloned into the pGEX-4T-2 vector by a method similar to that of DSK2 in Step 1 of Example 1 to obtain corresponding recombinant plasmids. The specific coding sequence of each ubiquitin-binding domain is as follows: 4UQ2 ubiquitin-binding domain (position 859-1008 of sequence 4+GGTGGAGGTGGATCTGGTGGAGGT+position 859-1008 of sequence 4+GGTGGAGGTGGATCTGGTGGAGGT+position 859-1008 of sequence 4+GGTGGAGGTGGATCTGGTGGAGGT+sequence 859-1008 of sequence 4), 4DSK2 ubiquitin binding domain (709-843 of sequence 3+GGTGGAGGTGGATC...

Embodiment 3

[0163] Example 3. Comparing the affinity characteristics of hybrid ubiquitin binding domains with different numbers in series and ubiquitin

[0164] In order to further screen for more efficient ubiquitinated protein enrichment and purification materials, the inventors of the present invention compared the affinity between hybrid ubiquitin binding domains and ubiquitin chains with different serial numbers.

[0165] 1. Expression and purification of hybrid ubiquitin-binding domain polypeptides with different numbers in tandem

[0166] 1. Construction of recombinant expression vector

[0167] There are three types of tandem ubiquitin binding domains involved in this example: DSK2-A20, 2(DSK2-A20) and 4(DSK2-A20). Each hybrid ubiquitin-binding domain was cloned into the pGEX-4T-2 vector by a method similar to that of DSK2 in Step 1 of Example 1 to obtain corresponding recombinant plasmids. The specific coding gene sequence of each ubiquitin binding domain is as follows: DSK2-A2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses artificially constructed hybrid ubiquitin conjugation structure domain polypeptide and an application thereof. The hybrid ubiquitin conjugation structure domain polypeptide is formed by connecting at least tow ubiquitin conjugation structures in series, and in all ubiquitin conjugation structure domains forming the hybrid ubiquitin conjugation structure domain polypeptide, at least two ubiquitin conjugation structure domain are different. In addition, the hybrid ubiquitin conjugation structure domain polypeptide can contain tag protein. The experiment shows that the tag protein disclosed by the invention can conjugate ubiquitin molecules and different ubiquitin chains carried in the ubiquitin molecules efficiently without unbiasedness, can improve the enrichment efficiency of on-scale ubiquitin protein, is used for developing efficient ubiquitin protein separation mediums and biologic reagents, and can provide technical methods for regulating in-vivo protein ubiquitination. The polypeptide is significant for prompting human disease sample ubiquitin proteomics study and development of health medicine.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to an artificially constructed hybrid ubiquitin binding domain polypeptide and its application, in particular to an artificially constructed hybrid ubiquitin binding domain polypeptide and its application in the study of protein ubiquitination modification . Background technique [0002] Ubiquitin itself is a small protein of 76 amino acids, named for its ubiquity in eukaryotic cells. Ubiquitin-proteasome system (Ubiquitin Proteasome System, UPS) is known to be well conserved, highly selective, and the most important intracellular protein-specific degradation pathway in all eukaryotic organisms. As the central regulatory signal of cells, protein ubiquitination has been involved in almost all processes of normal cell life activities, including protein degradation, protein clustering, DNA repair and cell apoptosis, and is closely related to many disease processes. Therefore, protein ubiqui...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N9/10C07K1/16
Inventor徐平高媛李衍常赵明治王京伟常蕾武军驻贺福初
OwnerACADEMY OF MILITARY MEDICAL SCI