Bacillus subtilis for producing N-acetylglucosamine as well as construction method and application of bacillus subtilis

A technology of Bacillus subtilis and acetamido, which is applied in the field of Bacillus subtilis and its construction, can solve the problems of low yield, unfavorable industrial production application, and high production cost, and achieve enhanced gene expression, high industrial utilization value, and prevention of backflow and the effect of consuming

Inactive Publication Date: 2014-12-10
张帆
View PDF8 Cites 23 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Patents CN103045527A, CN102978149A and CN103060252A disclose a series of methods for constructing N-acetylglucosamine-producing Bacillus subtilis engineering bacteria. Several strains of N-acetylglucosamine-producing Bacillus subtilis were constructed through genetic transformation, and the yields after fermentation reached 115 mg / L, 415mg / L and 1.23g / L, preliminarily solved the problem of the safety of N-acetylglucosamine produced by fermentation, but the highest fermentation yield of the above mentioned products was only 1.23g / L, and the low yield resulted in higher production costs, which was not conducive to industrialization production application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus subtilis for producing N-acetylglucosamine as well as construction method and application of bacillus subtilis
  • Bacillus subtilis for producing N-acetylglucosamine as well as construction method and application of bacillus subtilis
  • Bacillus subtilis for producing N-acetylglucosamine as well as construction method and application of bacillus subtilis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] 1. Knockout of the nagAB gene cluster in Bacillus subtilis 168 strain

[0035]1. According to the genome sequence of Bacillus subtilis 168 strain (Genbank No.NC_000964), design primers: upstream primer F-nagAB-up-BamHI:CT GGATCC GACTGCAAGATTTCGGCCTGGG (shown in SEQ ID NO.1) and downstream primer R-nagAB: CATAAGTCAGCATGTTCCTTTCACATAGATGATCCGCCTTTCTGG (shown in SEQ ID NO.2). Using the genomic DNA of Bacillus subtilis 168 strain as a template, the upstream 1000bp fragment of the nagAB gene cluster was amplified by PCR.

[0036] 2. According to the Bacillus subtilis 168 strain genome (Genbank No.NC_000964) sequence, design primers: upstream primer F-nagAB:CCAGAAAGGCGGATCATCTATGTGAAAGGAACATGCTGACTTATG (shown in SEQ ID NO.3) and downstream primer R-nagAB-down-NcoI:GCT CCATGG TAACGTATATACCAATGAAGAG (shown in SEQ ID NO. 4). Using the genomic DNA of Bacillus subtilis 168 strain as a template, a 1000 bp fragment downstream of the nagAB gene cluster was amplified by PCR.

[0...

Embodiment 2

[0044] 2. Continue to knock out the gamAP gene cluster in Bacillus subtilis

[0045] 1. According to the genome sequence of Bacillus subtilis 168 strain (Genbank No.NC_000964), design primers: upstream primer F-gamAP-up-BamHI:CT GGATCC ACTGCTCCCCACAGCACTTTTCC (shown in SEQ ID NO.5) and downstream primer R-gamAP: CGCAGCAGGGGGGACTTTTTTACATGTGACACCCCCTCAAAGAG (shown in SEQ ID NO.6). Using the genomic DNA of Bacillus subtilis 168 strain as a template, the upstream 1000bp fragment of the gamAP gene cluster was amplified by PCR.

[0046] 2. According to the sequence of Bacillus subtilis 168 strain genome (Genbank No.NC_000964), design primers: upstream primer F-gamAP:CTCTTTGAGGGGGTGTCACATGTAAAAAAGTCCCCCCTGCTGCG (shown in SEQ ID NO.7) and downstream primer R-gamAP-down-NcoI:GCT CCATGG ATACCACTCGTTTGGGACAGCC (shown in SEQ ID NO. 8). Using the genomic DNA of Bacillus subtilis 168 strain as a template, a 1000 bp fragment downstream of the gamAP gene cluster was amplified by PCR.

...

Embodiment 3

[0051] 3. Continue to knock out the nagP gene in Bacillus subtilis

[0052] 1. According to the genome sequence of Bacillus subtilis 168 strain (Genbank No.NC_000964), design primers: upstream primer F-nagP-up-BamHI:CT GGATCC CAAGACCTCCTCGTACAGAATAATG (shown in SEQ ID NO.9) and downstream primer R-nagP:GGTTGCCCCTCTCCGCTTTTTTACATACCCATCCCCCTCATACCC (shown in SEQ ID NO.10). Using the genomic DNA of Bacillus subtilis 168 strain as a template, the upstream 1000bp fragment of the nagP gene was amplified by PCR.

[0053] 2. According to the sequence of Bacillus subtilis 168 strain genome (Genbank No.NC_000964), design primers: upstream primer F-nagP:GGGTATGAGGGGGATGGGTATGTAAAAAAGCGGAGAGGGCAACC (shown in SEQ ID NO.11) and downstream primer R-nagP-down-NcoI:GCT CCATGG TTCCGGCGATTCTGAAGTCTAAG (shown in SEQ ID NO. 12). Using the genomic DNA of Bacillus subtilis 168 strain as a template, a 1000 bp fragment downstream of the nagP gene was amplified by PCR.

[0054] 3. Take 5ul of eac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the construction and the application of genetically engineered bacterium and particularly relates to bacillus subtilis for producing N-acetylglucosamine as well as a construction method and application of bacillus subtilis. The construction method for the genetically engineered bacterium (bacillus subtilis) comprises the following steps: expressing and coding 6-glucosamine phosphate synthetase gene and 6-glucosamine phosphate acetylase gene in bacillus subtilis to form a complete metabolic pathway from glucose to N-acetylglucosamine; knocking out or inactivating glucosamine 6-phosphate deaminase genes nagB and gamA, an N-acetylglucosamine 6-phosphate deacetylase gene nagA, a glucosamine transport protein gene gamP and an N-acetylglucosamine transport protein gene nagP in an N-acetylglucosamine catabolism pathway in bacillus subtilis. The construction method can be used for solving the problem that N-acetylglucosamine produced in the prior art is poor in safety, low in yield and high in cost. The constructed genetically engineered bacterium has the advantage that N-acetylglucosamine with relatively high concentration can be accumulated, and the industrial utilization value is relatively high.

Description

technical field [0001] The invention belongs to the construction and application of genetically engineered bacteria, in particular to a bacillus subtilis producing N-acetylglucosamine and its construction method and application. Background technique [0002] N-acetylglucosamine is a derivative of glucose, usually polymerized into chitin by beta-1,4-glycosidic bonds. Chitin is the second largest type of carbohydrate in nature after cellulose. It is widely found in fungi, algae, shells of shrimps, crabs, insects, and cell walls of higher plants. Therefore, N-acetylglucosamine is The stock of nature is huge. [0003] N-acetylglucosamine and D-glucuronic acid form repeated disaccharide units to form hyaluronic acid. Hyaluronic acid is a key substance for lubrication between joints and has an important protective effect on bone and joints. Experiments have proved that N-acetylglucosamine can be used as an effective drug for the treatment and prevention of joint diseases in midd...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/75C12P19/26C12R1/125
CPCC12N15/75C12P19/26C12N1/205C12R2001/125
Inventor张帆
Owner张帆