Gene silencing technology based gypsy moth chitinase gene and dsRNA
A technology of chitinase and gypsy moth, applied in DNA/RNA fragments, genetic engineering, DNA preparation, etc., can solve environmental pollution and other problems, achieve the effects of reducing production costs, reducing mass use, and rational design
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0015] The method for obtaining the full length of the chitinase 5 gene of the gypsy moth is as follows:
[0016] (1) Design of PCR primers
[0017] According to the known amino acid conservation sequence of insect chitinase 5, the following degenerate primers were designed as follows:
[0018] Upstream primer: CHT5F 5'-GAYTGGGAGTACCCHGG-3',
[0019] Downstream primer: CHT5R 5'-TCCATRTCRATRGCCCA-3';
[0020] (2) Design of RACE primers for chitinase 5 gene of Gypsy moth
[0021] Primers were designed based on the fragments obtained above as follows:
[0022] 5'RACE upstream primer: 5'- CGCTACGTAACGGCATGACAGTG(C) 16 -3'
[0023] 5' RACE downstream primer: 5'- GGTGTACGGAGCAGGATCGCCACC-3'
[0024] 3' RACE upstream primer: 5'- GCTGGATGCTATCCACGTGATGTCG-3'
[0025] 3'RACE downstream primer: 5'- CGCTACGTAACGGCATGACAGTG(T) 18 -3'
[0026] All primers were synthesized by Shanghai Yingwei Jieji Biological Co., Ltd.
[0027] (3) Obtaining total RNA of Gypsy moth
[0028] The 4...
Embodiment 2
[0037] The method for obtaining the lethal fragment of the gypsy moth chitinase 5 gene is as follows:
[0038] According to the nucleotide sequence of the gypsy moth chitinase 5 gene obtained in Example 1, specific primers were designed using primerpremier5.0 software, the upstream primer sequence is SEQ ID NO: 3, and the downstream primer sequence is SEQ ID NO: 4 , all primers were synthesized by Shanghai Yingwei Jieji Biological Co., Ltd.; among them, the upstream primer and downstream primer need to be designed for the nucleotide sequence of the gypsy moth chitinase 5 gene obtained in Example 1. After the design of upstream and downstream primers and careful screening of multiple gene fragments, the lethal gene fragment with practical application effect was finally determined.
[0039] The recombinant pEASY-T1 plasmid successfully ligated with the gypsy moth chitinase 5 gene obtained in Example 1 was used as a template, and the lethal fragment of the gypsy moth chitinase 5 ...
Embodiment 3
[0042] Obtaining the dsRNA of the Lethal Fragment of Chitinase 5 Gene of Gypsy Moth
[0043] The chitinase 5 gene lethal fragment obtained in Example 2 was used to synthesize dsRNA by in vitro transcription according to the instructions of the T7RiboMAX Express RNAi System (Promega) kit. The obtained dsRNA was detected by 1.5% agarose gel electrophoresis, its concentration was detected by a microplate reader (Thermo Scientific Multiskan GO, Thermo Fisher Scientific, USA), and concentrated to a final concentration of 1 μg / μl and stored at -80°C spare.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
