Method for detecting HLA-B * 5801 allele based on real-time fluorescence PCR
A technology of HLA-B and alleles, applied in the field of alleles, can solve the problems of difficult combination of primers and probes, and achieve the effects of saving experimental time and consumables, short time consumption, and easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment
[0041] Specific examples TaqMan-MGB probe method for detection of HLA-B*5801 alleles
[0042] 1. DNA sample extraction and dilution
[0043] After collecting venous blood in vacuum blood collection tubes anticoagulated with ethylenediaminetetraacetic acid (EDTA) according to conventional methods, DNA was extracted using the QIAamp DNA Mini Blood Kit (Qiagen, Germany) kit; the extracted DNA was concentrated using NanoDrop 2000 Determination (A 260 / 280 =1.95~2.15). Using the above method, the concentration of DNA samples of 104 cases of Bouyei was measured, and then the samples were diluted to 10 ng / μL with PCR-grade H2O.
[0044] 2. Design primers and probes
[0045] In the area where the polymorphic sites are concentrated, use the ARMS method to design specific primers for HLA‐B*5801, the upstream primer F: 5'‐GGGCCGGAGTATTGGGATG‐3', the downstream primer R: 5'‐TTGGCCTCAACTGAAAATGAAAC‐3', and matching Fluorescent probe probe: 5'‐HEX / VIC‐TCAGGGAGGCGGATCTCGGAC–MGB‐3'; In add...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 