Application of male sterility gene OsLAP5 and method for recovering rice male sterility

A male sterility gene and male sterility technology, applied in the fields of application, horticultural methods, genetic engineering, etc., can solve the difficulty of screening excellent combinations, the complex performance of three-line hybrid rice seeds, the limitation of the relationship between the restorer line and the maintainer line, etc. question

Active Publication Date: 2015-01-28
SHANGHAI JIAO TONG UNIV
View PDF2 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the performance of three-line hybrid rice seed dominance is complex, limited by the relationship between the restorer line and the maintainer line, making it difficult to select excellent combinations

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of male sterility gene OsLAP5 and method for recovering rice male sterility
  • Application of male sterility gene OsLAP5 and method for recovering rice male sterility
  • Application of male sterility gene OsLAP5 and method for recovering rice male sterility

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1, the method for the creation of rice male sterile lines

[0042] 1.1 Create oslap5 rice male sterile lines by genetic engineering or other means

[0043] The sequence of the coding region of the OsLAP5 gene in this example is shown in SEQ ID NO.2. The osalp5 mutant material in this example was obtained from the conventional japonica rice variety Wuyujing No. 7 (also known as 9522) through RNA interference or sequence variation of the OsLAP5 gene.

[0044] 1.2 Cloning of rice fertility control protein gene

[0045] Utilize the population of rice gene location cloning (map-based cloning or position cloning) that comprises the fertility control protein gene OsLAP5 and its mutant gene oslap5 that the inventor constructed, and is clear to those skilled in the art. Within the genome fragment, for example, within 100Kb. On this basis, a genomic DNA clone containing the fragment was isolated by a conventional method. Sequencing and further hybridization identif...

Embodiment 2

[0067] Example 2 The use of oslap5 mutants in rice seed production

[0068] The oslap5 mutant was used as the male parent to cross the sterile parent in the three-line or two-line cross combination to obtain the F1 generation. In the F2 generation, a plant with both male sterility and sterility characteristics was screened, and the plant was crossed with the maintainer line corresponding to the original sterile parent. In the F2 generation, the plants with both male sterility and sterility characteristics were screened again and crossed with the maintainer line. After multiple generations of cross screening, a new male sterile line was obtained, which was suitable as the female parent in the hybrid combination.

Embodiment 3

[0069] Embodiment 3 restores the method for the male sterility character of oslap5 mutant

[0070] Transferring the genomic nucleotide sequence encoding the OsLAP5 gene into the mutant oslap5 plant can restore the mutant to the wild-type phenotype.

[0071] Primers used from rice Nipponbare BAC clone (OSJNba29L07):

[0072] OsMS16hb-F:5'AATCTAGAGGTAGGCACAAGGATGGCAA 3'(XbaI)SEQ ID NO.11 and

[0073] OsMS16hb-R:5'AAGGTAACCGTTGAACTTTGTTTGTGGAGTGA3'(BstEII) SEQ ID NO.12

[0074] A 3575bp (SEQ ID NO.1) genome sequence fragment of the OsLAP5 gene was amplified.

[0075] The fragment was inserted into the binary vector pCAMBIA1301 vector used for transformation of rice through XbaI and BstEII; the sequence verification was correct, and the vector was introduced into Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105CGMCC No.4819 by electric shock to obtain OsLAP5 complementary Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105, using genetic transformation me...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to application of male sterility gene OsLAP5 and a method for recovering rice male sterility, belonging to the technical field of rice breeding. A base sequence of the male sterility gene OsLAP5 is as shown in SEQ ID NO.2. The application is as follows: the OsLAP5 gene is knocked out or inhibited so that activity of rice sporopollenin synthetase loses or expression level of the rice sporopollenin synthetase drops; and an obtained new rice male sterile line can be used for producing hybrid seeds. Furthermore, the invention relates to a method for creating a rice male sterile strain, application of the rice sterile strain in production of rice seeds and a method for recovering a male sterile character. The rice mutant disclosed by the invention has no abnormity in a vegetative growth stage, but a homozygote plant is completely sterile. The method, if applied to hybrid seeding, can avoid an operation of castration of female parent, greatly improve production efficiency and reduce labor cost, and the method has good application on agricultural production.

Description

technical field [0001] The invention belongs to the technical field of rice breeding, and in particular relates to the application of a male sterility gene OsLAP5 and a method for restoring male sterility in rice. Background technique [0002] Rice is one of the main food crops in the world, and it is the most important food crop in my country. China is the largest rice producer and consumer in the world, and more than 60% of Chinese people use rice as a staple food. The annual sown area of ​​rice in my country exceeds 30 million hectares, accounting for 20% of the world and 30% of the country's sown area of ​​grain crops; The average crop yield is more than 45% higher; the yield per unit area is 6.35 tons / ha, which is 65% higher than the global average yield of 3.85 tons / ha. One of the important factors is the widespread cultivation of hybrid rice. [0003] Male sterile line: refers to a female rice with degenerated males (mainly degenerated pollen) but normal pistils. Du...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/84A01H5/00A01H4/00A01H1/02
Inventor 张大兵朱晓雷梁婉琪袁政
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap